We narrowed to 13,948 results for: CRISPR-Cas9
-
Plasmid#169029PurposegRNA-marker vector contain a U6:3 promoter, gRNA scaffold, and a Ubi-mTagBFP-NLS marker.DepositorTypeEmpty backboneUseCRISPRExpressionInsectPromoterU6:3Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pENTR-R4R3-3xmEGFP-C
Plasmid#113751PurposeGateway multi-site entry clone for second position 3x mEGFP (C-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmEGFP-mEGFP-mEGFP
UseCRISPR; Gateway entry vectorTags3xmEGFPAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOC4 Actb-mRuby3 KI
Plasmid#183437PurposeFlpON knock-in for mRuby3-beta-actin (amino acid position: before start codon)DepositorInsertgRNA and mRuby3 donor
UseCRISPRExpressionMammalianAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC5 Tubb3-GFP KI
Plasmid#183440PurposeFlpOFF knock-in for beta3-tubulin GFP (amino acid position: stop codon)DepositorInsertgRNA and GFP donor
UseCRISPRAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ138A
Plasmid#69280PurposeGolden Gate entry vector; 8th gRNA under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYPQ137A
Plasmid#69279PurposeGolden Gate entry vector;7th gRNA under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-3xmRuby-N
Plasmid#113754PurposeGateway multi-site entry clone for second position 3x mRuby (N-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmRuby2-mRuby2-mRuby2
UseCRISPR; Gateway entry vectorTags3xmRuby2Available SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIK198
Plasmid#65629Purpose"flipped and extended" sgRNA backbone (Chen et al., 2013) following a C. elegans U6 promoter (Friedland et al., 2013). For Gibson cloning locus-specific sgRNA sequences.DepositorTypeEmpty backboneUseCRISPRExpressionWormPromoterU6Available SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Tubb3-4xGFP KI
Plasmid#183445PurposeGFP knock-in for beta3-tubulin-GFP (amino acid position: stop codon)DepositorInsertgRNA and 4xGFP donor
UseCRISPRExpressionMammalianAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-mEGFP-N
Plasmid#113746PurposeGateway multi-site entry clone for second position mEGFP (N-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmEGFP
UseCRISPR; Gateway entry vectorTagsmEGFPAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-mEGFP-C
Plasmid#113749PurposeGateway multi-site entry clone for second position mEGFP (C-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmEGFP
UseCRISPR; Gateway entry vectorTagsmEGFPAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-mRuby-C
Plasmid#113755PurposeGateway multi-site entry clone for second position mRuby (C-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmRuby2
UseCRISPR; Gateway entry vectorTagsmRuby2Available SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-3xmRuby-C
Plasmid#113757PurposeGateway multi-site entry clone for second position 3x mRuby (C-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmRuby2-mRuby2-mRuby2
UseCRISPR; Gateway entry vectorTags3xmRuby2Available SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGMF2-D
Plasmid#242206PurposeAtU6-26p::sgRNA scaffold in L1 vector backbone, for subcloning of 2nd 20 bp target sequence. For use in dicots.DepositorInsertLevel1 AtU6-26p::sgRNA2 for subcloning of 20 bp target sequence
UseCRISPR and Synthetic BiologyExpressionPlantPromoterAtU6-26pAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJAT58
Plasmid#204304PurposeExpresses jGCaMP7s-T2A-tdTomato under UAS control. HDR event marked with removable 3XP3-DsRed cassette expressed in eyes.DepositorInsert3XP3-DsRed
UseCRISPRPromoter3XP3Available SinceAug. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-mGreenLantern332
Plasmid#188483PurposegRNA plasmid with neomycin resistance expressing a single guide RNA targeting mGreenLantern fluorescent protein site 332.DepositorInsertmGreenLantern sgRNA
UseCRISPRTagsPB_rtTA_BsmBIExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-CMV152
Plasmid#188485PurposegRNA plasmid with neomycin resistance expressing a single guide RNA targeting cytomegaloviral promoter site 152.DepositorInsertCMV promoter sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-tdTomato166/892
Plasmid#188488PurposegRNA plasmid with neo resistance expressing a double cutting single gRNA targeting tdTomato fluorescent protein sites 166 & 892.DepositorInserttdTomato sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-tdTomato90/816
Plasmid#188487PurposegRNA plasmid with neo resistance expressing a double cutting single gRNA targeting tdTomato fluorescent protein sites 90 & 816.DepositorInserttdTomato sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-CMV162
Plasmid#188486PurposegRNA plasmid with neomycin resistance expressing a single guide RNA targeting cytomegaloviral promoter site 162.DepositorInsertCMV promoter sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-CMV51
Plasmid#188484PurposegRNA plasmid with neomycin resistance expressing a single guide RNA targeting cytomegaloviral promoter site 51.DepositorInsertCMV promoter sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-mGreenLantern/EGFP
Plasmid#188482PurposegRNA plasmid with neomycin resistance expressing a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Tubb3-2xGFP KI
Plasmid#183443PurposeGFP knock-in for beta3-tubulin-GFP (amino acid position: stop codon)DepositorInsertgRNA and 2xGFP donor
UseCRISPRExpressionMammalianAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC4 Kcnn2-smFP-myc KI
Plasmid#183438PurposeFlpON knock-in for SK2-smFP-myc (amino acid position: T571)DepositorInsertgRNA and smFP myc donor
UseCRISPRExpressionMammalianAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC2 GFP-Mpp2 KI
Plasmid#183434PurposeCreOFF knock-in for GFP-MPP2 (amino acid position: A4)DepositorInsertgRNA and GFP donor
UseCRISPRExpressionMammalianAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC5 smFP-HA-Cacna1e KI
Plasmid#183441PurposeFlpOFF knock-in for smFP-HA-CaV2.3 (amino acid position: G5)DepositorInsertgRNA and smFP HA donor
UseCRISPRAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC2 Gria1-Halo KI
Plasmid#183433PurposeCreOFF knock-in for GluA1-Halo (amino acid position: stop codon)DepositorInsertgRNA and Halo donor
UseCRISPRAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Tubb3-3xGFP KI
Plasmid#183444PurposeGFP knock-in for beta3-tubulin-GFP (amino acid position: stop codon)DepositorInsertgRNA and 3xGFP donor
UseCRISPRExpressionMammalianAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC2 Tubb3 no donor
Plasmid#183431PurposeCreOFF gRNA expression for beta3-tubulin (amino acid position: stop codon)DepositorInsertgRNA
UseCRISPRAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC2 GFP-Actb KI
Plasmid#183429PurposeCreOFF knock-in for GFP-beta-actin (amino acid position: before start codon)DepositorInsertgRNA and GFP donor
UseCRISPRAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC2 Gria1-GFP KI
Plasmid#183430PurposeCreOFF knock-in for GluA1-GFP (amino acid position: stop codon)DepositorInsertgRNA and GFP donor
UseCRISPRAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC-U63-tgRNA-Gal80
Plasmid#169030PurposegRNA-marker vector contain a U6:3 promoter, gRNA scaffold, and a Ubi-Gal80 marker.DepositorTypeEmpty backboneUseCRISPRExpressionInsectPromoterU6:3Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP1
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP2
Plasmid#113973PurposeSingle short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP3
Plasmid#113974PurposeSingle short guide RNA targeting CGTGATGTTGTACCGCTTC in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-mRuby-N
Plasmid#113752PurposeGateway multi-site entry clone for second position mRuby (N-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmRuby2
UseCRISPR; Gateway entry vectorTagsmRuby2Available SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-2xmEGFP-N
Plasmid#113747PurposeGateway multi-site entry clone for second position 2x mEGFP (N-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmEGFP-mEGFP
UseCRISPR; Gateway entry vectorTags2xmEGFPAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-3xmEGFP-N
Plasmid#113748PurposeGateway multi-site entry clone for second position 3x mEGFP (N-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmEGFP-mEGFP-mEGFP
UseCRISPR; Gateway entry vectorTags3xmEGFPAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-2xmEGFP-C
Plasmid#113750PurposeGateway multi-site entry clone for second position 2x mEGFP (C-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmEGFP-mEGFP
UseCRISPR; Gateway entry vectorTags2xmEGFPAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-2xmRuby-N
Plasmid#113753PurposeGateway multi-site entry clone for second position 2x mRuby (N-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmRuby2-mRuby2
UseCRISPR; Gateway entry vectorTags2xmRuby2Available SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only