We narrowed to 4,407 results for: crispr c plasmids
-
Plasmid#208387PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ZBP1#1 gene.DepositorAvailable sinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only
-
Lenti-sgRNA-Cre-GpNLuc-sgmZBP1#2
Plasmid#208388PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine ZBP1#2 gene.DepositorAvailable sinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF1a-CRY2PHR-SID4X
Plasmid#63663PurposeAAV expression of CRYS2PHR-SID4XDepositorInsertSID4X-CYR2PHR
UseAAVExpressionMammalianPromoterEF1alphaAvailable sinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Dot1LCD-CatMut
Plasmid#235591PurposeDox-inducible expression of control catalytic-mutant Dot1l CD fused with scFVDepositorAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Setd2CD-CatMut
Plasmid#235588PurposeDox-inducible expression of control catalytic-mutant Setd2 CD fused with scFVDepositorAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX601‐mhCMV‐miniABEmax‐N3‐ E53ogRNA
Plasmid#187064PurposeNpu Split N-terminal half of ABEmaxNGA with gRNA targeting mdx4cv nonsense mutationDepositorInsertminiABEmax-Npu
UseAAV and CRISPRExpressionMammalianPromotermhCMVAvailable sinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJET-42-DExCon-antiGFPnanobody-mCherry-R11a
Plasmid#179902PurposeDonor with homologous arms for Rab11a to knock in DExCon-antiGFPnanobody-mCherry moduleDepositorInsertRAB11A, member RAS oncogene family (RAB11A Human)
UseCRISPR; Donor for homologous based knock inTagsantiGFPnanobody-mCherryExpressionBacterial and MammalianPromoterTRE3GSAvailable sinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
Little Prince-enOsCas12f1
Plasmid#251232PurposeDrug inducible gene editing system based on enOsCas12f1 (Little Prince)DepositorInsertH1-TetO-enOsCas12f1 sgRNA scaffold; Core EF1α-opTtetR; enOsCas12f1; NES; StaPLs-TI; 3×BPNLS; GFP
UseAAV and CRISPRExpressionMammalianAvailable sinceJuly 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
Little Prince (TnpB)
Plasmid#251233PurposeDrug inducible gene editing system based on TnpB (Little Prince)DepositorInsertH1-TetO-TnpB ωRNA* scaffold; Core EF1α-opTtetR; TnpB; NES; StaPLs-TI; 3×BPNLS; GFP
UseAAV and CRISPRExpressionMammalianAvailable sinceJuly 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
Little Prince (enIscB)
Plasmid#251234PurposeDrug inducible gene editing system based on enIscB (Little Prince)DepositorInsertH1-TetO-enIscB ωRNA* scaffold; Core EF1α-opTtetR; enIscB; NES; StaPLs-TI; 3×BPNLS; GFP
UseAAV and CRISPRExpressionMammalianAvailable sinceJuly 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS423-TyrSgH
Plasmid#163973PurposeHelper plasmid for cloning gRNAs under the control of the tRNA(Tyr) promoterDepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable sinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS423-SgH
Plasmid#163972PurposeHelper plasmid for cloning gRNAs under the control of the SNR52 promoter.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable sinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOT_4 - lenti-EFS-FMC6.3-BBz-2A-puro-2A-LTBR
Plasmid#181973PurposeExpresses anti-CD19 CAR (with 4-1BB signaling domain) linked to puromycin resistance via P2A and to human LTBR via T2A for lentiviral delivery.DepositorInsertFMC6.3-BBz CAR; LTBR (LTBR Synthetic, Human)
UseLentiviralAvailable sinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTarget-TTC
Plasmid#246930Purposefor E.coli plasmid interference and PAM depletion assaysDepositorInsertTTC PAM and GFP-T1 target
UseUnspecifiedAvailable sinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMV_Puro_SFB_GNB1L_WD 7 deletion
Plasmid#224388PurposeLenti plasmid for generating GNB1L _WD 7 domain depleted expressing stable cell linesDepositorInsertGNB1L (GNB1L Human)
ExpressionBacterial and MammalianMutationWD 7 domain deleted (aa 286-323)Available sinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMV_Puro_SFB_GNB1L_WD 6 deletion
Plasmid#224387PurposeLenti plasmid for generating GNB1L _WD 6 domain depleted expressing stable cell linesDepositorInsertGNB1L (GNB1L Human)
ExpressionBacterial and MammalianMutationWD 6 domain deleted (aa 242-282)Available sinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMV_Puro_SFB_GNB1L_WD 4 deletion
Plasmid#224385PurposeLenti plasmid for generating GNB1L _WD 4 domain depleted expressing stable cell linesDepositorInsertGNB1L (GNB1L Human)
ExpressionBacterial and MammalianMutationWD 4 domain deleted (aa 153-195)Available sinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAT_g1 gRNA
Plasmid#86005Purposeplasmid vector encoding for U6-driven AAT_g1 gRNADepositorInsertpU6-AAT_g1 sgRNA
UseCRISPRExpressionMammalianPromoterpU6Available sinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAT_g2 gRNA
Plasmid#86006Purposeplasmid vector encoding for U6-driven AAT_g2 gRNA (Z-allele specific)DepositorInsertpU6-AAT_g2 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available sinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX601-Nlgn2-gRNA2-GfaABC1D-mCherry
Plasmid#250933PurposeNlgn2 gRNA #2 targeting Rat Nlgn2. Also expresses SaCas9 T2a mCherry under the astrocyte promoter gfaABC1DDepositorAvailable sinceJune 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX601-Nlgn2-gRNA3-GfaABC1D-mCherry
Plasmid#250934PurposeNlgn2 gRNA #3 targeting Rat Nlgn2. Also expresses SaCas9 T2a mCherry under the astrocyte promoter gfaABC1DDepositorAvailable sinceJune 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-SaKKH-U6-sgRNA scaffold
Plasmid#226935PurposeEncoding SaKKHABE8e and sgRNA cassette on a single AAVDepositorInsertTadA8e, nSaKKHCas9
UseAAVPromoterEFSAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-nSpCas9(D10A)-BPNLS(SV40)-3xFLAG-P2A-EGFP (HES24)
Plasmid#185492PurposeCMV and T7 promoter expression plasmid for human codon usage nSpCas9(D10A) with a C-terminal bi-partite NLS, 3x FLAG, and P2A-eGFPDepositorInserthuman codon usage nSpCas9(D10A)-BPNLS-P2A-eGFP
UseIn vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-eGFPExpressionMammalianMutationD10APromoterCMV and T7Available sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgLacZ-U6-sgGFP-hSyn1-mCherry
Plasmid#208834PurposeControl plasmid expresses mCherry under the hSyn1 promoter with sgRNAs against LacZ and GFPDepositorInsertmCherry
UseAAV and CRISPRExpressionBacterial and MammalianPromoterhSyn1Available sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKSB-AeU6-3gRNA
Plasmid#183914PurposegRNA-expressing plasmid under Aedres aegypti AAEL017763 U6 promoterDepositorInsertgRNA scaffold for protospacer cloning into BbsI sites
PromoterAedes aegypti U6 promoter (AAEL017763)Available sinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only