We narrowed to 11,760 results for: CHL
-
Plasmid#231162PurposeT-DNA encoding TRV2 with mobile gRNA targeting SlCHL1DepositorInsertmobile gRNA targeting SlCHL1
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
PtetA-PBAD-PLacO3O1 200bp with pBELO_L6-PT3-T4_CAMR_TAN+
Plasmid#225649PurposetetA, araBAD and LacO3O1 promoters in tandem conformation with 200bp distance between them, expressing mCherry with pBELO_L6-PT3-T4 backbone and chloramphenicol resistanceDepositorInserttetR/tetA, araBAD and LacO3O1 in tandem conformation
TagsmCherryExpressionBacterialPromotertetA, araBAD and LacO3O1 promotersAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACB143
Plasmid#222214PurposeFor recombinant expression of vanB (PP_3737 from Pseudomonas putida) with the A24P mutation and an N-terminal thrombin-cleavable His tagDepositorInsertvanB(A24P)
TagsN-terminal, thrombin-cleavable 6x His tagExpressionBacterialMutationChanged Alanine 24 to ProlinePromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSN95
Plasmid#222220PurposeFor recombinant expression of vanA (PP_3736 from Pseudomonas putida) with a C-terminal His tagDepositorInsertvanA putida (PP_RS19450 Pseudomonas putida KT2440)
Tags6x HisExpressionBacterialPromoterT5-lacAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACB109
Plasmid#222208PurposeFor recombinant expression of fghA (PP_1617 from Pseudomonas putida) with the K10N mutation and a C-terminal His tagDepositorInsertfghA (K10N)
Tags6x HisExpressionBacterialMutationChanged Lys10 to AsnPromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACB110
Plasmid#222209PurposeFor recombinant expression of fghA (PP_1617 from Pseudomonas putida) with the G258D mutation and a C-terminal His tagDepositorInsertfghA (G258D)
Tags6x HisExpressionBacterialMutationChanged Gly258 to AspartatePromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACB111
Plasmid#222210PurposeFor recombinant expression of fghA (PP_1617 from Pseudomonas putida) with the G76V mutation and a C-terminal His tagDepositorInsertfghA(G76V)
Tags6x HisExpressionBacterialMutationChanged glycine 76 to valinePromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACB112
Plasmid#222211PurposeFor recombinant expression of fghA (PP_1617 from Pseudomonas putida) with the S11R mutation and a C-terminal His tagDepositorInsertfghA(S11R)
Tags6x HisExpressionBacterialMutationChanged Serine 11 to ArgininePromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACB113
Plasmid#222212PurposeFor recombinant expression of fghA (PP_1617 from Pseudomonas putida) with the W15C mutation and a C-terminal His tagDepositorInsertfghA(W15C)
Tags6x HisExpressionBacterialMutationChanged Tryptophan 15 to CysteinePromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJFRC-10XUAS-FRT-STOP-FRT-myrTdtomato-2A-KDR::Pest
Plasmid#217514PurposeEncodes a UAS controlled and Flp dependent conditional trangene of bicistronic myrTdtomato and KD RecombinaseDepositorInsert10XUAS-FRT-STOP-FRT-myrTdtomato-2A-KDR::Pest
ExpressionInsectAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
p204-U6-Switch-ON
Plasmid#217883PurposeRetroviral Switch-ON vector for sgRNA expression; U6-BbsIx2-SWITCH-ON-scaffold; neoRDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and RetroviralExpressionMammalianPromoterhU6Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEG302-HD2C-ZF
Plasmid#200917PurposeExpress HD2C-ZF108 in Arabidopsis target FWA geneDepositorInsertHD2C (HD2C Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-CPL2-ZF
Plasmid#200918PurposeExpress CPL2-ZF108 in Arabidopsis target FWA geneDepositorInsertCPL2 (CPL2 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-JMJ18-ZF
Plasmid#200919PurposeExpress JMJ18-ZF108 in Arabidopsis target FWA geneDepositorInsertJMJ18 (JMJ18 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-ELF7-ZF
Plasmid#200920PurposeExpress ELF7-ZF108 in Arabidopsis target FWA geneDepositorInsertELF7 (ELF7 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMDC123-DMS3-ZF
Plasmid#200921PurposeExpress DMS3-ZF108 in Arabidopsis target FWA geneDepositorInsertDMS3 (DMS3 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMDC123-SUVH2-ZF
Plasmid#200922PurposeExpress SUVH2-ZF108 in Arabidopsis target FWA geneDepositorInsertSUVH2 (SUVH2 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMDC123-SUVH9-ZF
Plasmid#200923PurposeExpress SUVH9-ZF108 in Arabidopsis target FWA geneDepositorInsertSUVH9 (SUVH9 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302-TRB2-ZF
Plasmid#200926PurposeExpress TRB2-ZF108 in Arabidopsis target FWA geneDepositorInsertTRB2 (TRB2 Mustard Weed)
ExpressionPlantAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only