We narrowed to 1,005 results for: Psp
-
Plasmid#176234PurposeVector plasmid for expressing spCas9-POLI fusion protein and sgRNA. There are two copies of HBB 3’ UTR in the 3’UTR of spCas9-POLI to enhance expression. The ST2 loop of the sgRNA scaffold was replaceDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pMJ273: pRS426-His-MBP-GtFz1_PSP1
Plasmid#205258PurposeS. cerevisiae expression vector for GtFz1 reprogrammed guide (targeting PSP1)DepositorInsertGtFz1
UseTags10xHis, MBPExpressionYeastMutationPromoterAvailable sinceAug. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMJ127: pRS426-His-MBP-NlovFz2_PSP1
Plasmid#205257PurposeS. cerevisiae expression vector for NlovFz2 reprogrammed guide (targeting PSP1)DepositorInsertNlovFz2
UseTags10xHis, MBPExpressionYeastMutationPromoterAvailable sinceAug. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-ABE-3'UTR-sgRNA-2xMS2
Plasmid#132554PurposeVector plasmid expressing ABEmax and sgRNA scaffold with MS2 replacing the Tetraloop and loop 2DepositorInsertsABEmax
sgRNA, with Tetraloop and loop 2 replaced by MS2 aptamer
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSP64TS human TGFbeta-IIR (DM#169)
Plasmid#15012DepositorInsertTGF beta type II receptor (TGFBR2 Human)
UseSp6 expression for use in xenopusTagsExpressionMutationPromoterAvailable sinceOct. 18, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSP64T3 BMP2 pro Vg1 (DM#119)
Plasmid#15071DepositorInsertBMP2-Vg1
UseSp6 expression for use in xenopusTagsExpressionMutationPromoterAvailable sinceOct. 18, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-RAB7A-gRNA2 (PX459)
Plasmid#221552PurposeExpresses Cas9 and gRNA for disruption of Rab7A gene in human cellsDepositorInsertgRNA targeting human Rab7A (RAB7A Human)
UseTagsExpressionMammalianMutationPromoterU6Available sinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCA28-pMa-PspCas13b crRNA-TS1
Plasmid#199459PurposeU6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC )DepositorInsertTS1 crRNA
UseCRISPRTagsExpressionMutationPromotermouse U6Available sinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::RfA
Plasmid#186407PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined gene of interest under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorTagsExpressionMutationPromoterAvailable sinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::HA-RfA
Plasmid#186411PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined fusion N-ter HA tag-gene of interest under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorTagsExpressionMutationPromoterAvailable sinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
PDEST-pSP172BSSPE-pFOGc::RfA-ECFP
Plasmid#186403PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter ECFP under control of the pFOG ectodermal regulatory sequence.DepositorTypeEmpty backboneUseGateway destination vectorTagsExpressionMutationPromoterAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-Swa1::RfA-ECFP
Plasmid#186402PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter eCFP under control of a reg. sequence in the Swa1 restriction site.DepositorTypeEmpty backboneUseGateway destination vectorTagsExpressionMutationPromoterAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-pFOGc::RfA-venus
Plasmid#186401PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter Venus under control of the pFOG ectodermal regulatory sequence.DepositorTypeEmpty backboneUseGateway destination vectorTagsExpressionMutationPromoterAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-pFOGc::venus-RfA
Plasmid#186400PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of N-ter Venus and a gene of interest under control of the pFOG ectodermal regulatory sequence.DepositorTypeEmpty backboneUseGateway destination vectorTagsExpressionMutationPromoterAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-Swa1::venus-RfA
Plasmid#186398PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of N-ter Venus and a gene of interest under control of a reg. sequence in the Swa1 restriction site.DepositorTypeEmpty backboneUseGateway destination vectorTagsExpressionMutationPromoterAvailable sinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::RfA-HA
Plasmid#186410PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined fusion gene of interest-C-ter HA tag under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorTagsExpressionMutationPromoterAvailable sinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::B1-NLSLacZ-B2
Plasmid#186413PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined NLSLacZ under control of an AttB3/B5 recombined reg. sequence.DepositorInsertlacZ (lacZ E. coli)
UseGateway destination vectorTagsNuclear localization signalExpressionMutationPromoterAvailable sinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3exo-Tetra-com-CLCN5-sp-g1
Plasmid#176236PurposePlasmid for expressing a fusion protein of spCas9 and the 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-5Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176237PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176238PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-B2
Plasmid#165083PurposegRNA 2 of pair B for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationPromoterCMVAvailable sinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-C1
Plasmid#165085PurposegRNA 1 of pair C for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationPromoterCMVAvailable sinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-C2
Plasmid#165086PurposegRNA 2 of pair C for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationPromoterCMVAvailable sinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSP64T3 BMP2 pro dnmVg1 (DM#182)
Plasmid#15074DepositorInsertBMP2-Vg1 dom neg
UseSp6 expression for use in xenopusTagsExpressionMutationdominant negative version of BMP2-Vg1 chimera. Th…PromoterAvailable sinceOct. 18, 2007AvailabilityAcademic Institutions and Nonprofits only -
HOXB13 (human) Myc-tag-pSP72
Plasmid#8682DepositorInsertHOXB13 (HOXB13 Human)
UseTnt in vitroTagsMycExpressionBacterialMutationnew NsiI site at ATG startPromoterAvailable sinceMay 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
pC0048-CMV-dPspCas13b-longlinker-ADAR2DD(E488Q)
Plasmid#103864PurposedPspCas13b-ADAR2DD(E488Q) fusion that can be used to selectively edit adenosine to inosine in RNA molecules when used in conjuction with a guide RNA. Longer linker than pC0039.DepositorInsertsUseCRISPRTagsGSGGGGS and HIV NESExpressionMammalianMutationChanged histidne 133 to alanine and histidine 105…PromoterAvailable sinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-3*Flag-APEX2 N-term PSPC1
Plasmid#187579PurposeExpress FLAG epitope and APEX2-tagged PSPC1 fusion protein in mammalian cellsDepositorInsertPSPC1 (PSPC1 Human)
UseTagsAPEX2-FLAGExpressionMammalianMutationPromoterCMVAvailable sinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ef1a-pspCas13b-NES-3xFLAG-T2A-BFP
Plasmid#173029PurposeFor expression of cytoplasmic pspCas13b protein tagged with 3xHA-T2A-BFP for gene silencing in mamallian cells.DepositorInsertpspCas13b
UseCRISPR and LentiviralTags3xFLAG, BFP, HIV NES, and T2AExpressionMammalianMutationPromoterEf1aAvailable sinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ikaros-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)
Plasmid#75240PurposeCRISPR/Cas9 plasmid against human IkarosDepositorInsertsgRNA against human Ikaros (IKZF1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cmv d0 dPspCas13b-GGS-NYTHDF1(100-200)
Plasmid#119857PurposeCmv d0 dPspCas13b-GGS-NYTHDF1(100-200) (YTHDF1 100-200 subdomain)DepositorInsertdCas13b-GGS-NYTHDF1(100-200)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 19, 2018AvailabilityAcademic Institutions and Nonprofits only