We narrowed to 4,492 results for: BRE
-
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMVA2RBS035
Plasmid#121051PurposeExpresses recombinant MVA pathway in Escherichia coliDepositorInsertsmvaE
mvaS
mvaK1
mvaK2
mvaD
idi
Available SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE_hygro_mRFP1_NRF2
Plasmid#136579Purposemammalian expression of mRFP1-tagged human NRF2DepositorAvailable SinceJuly 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRRL-CAG-NR5A1-FLAG
Plasmid#242229PurposeExpression of full-length human SF-1 using lentivirusDepositorAvailable SinceSept. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBabe RFP1-KRT5 hygro
Plasmid#58493Purposemammalian expression of mRFP1-tagged human KRT5DepositorAvailable SinceAug. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pC1-dmito-oROS-HT
Plasmid#216418PurposeTargeting of the chemigenetic, fluorescent peroxide sensor oROS-HT to mitochondrial matrix.DepositorInsertdmito-oROS-HT
ExpressionMammalianPromoterCMVAvailable SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Rab27B Q78L
Plasmid#89448PurposeExpression of GFP-tagged human Rab27B Q78L in mammalian cellsDepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-hygro
Plasmid#160090PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance markerDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-FNLS-P2A-Puro
Plasmid#110841PurposeLentiviral vector for constitutive expression of FNLS in mammalian cells (codon optimized)DepositorInsertBE3RA-FNLS
UseLentiviralTags3X FLAGMutationD10A and NLS sequence at the N-terminusPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-RIGI-Apex- T2A-EGFP
Plasmid#167288PurposeLentiviral expression plasmid encoding an APEX2 RIG-I fusion product in frame with a self-cleaving eGFP. APEX biotin ligase can biotynilate RNAs in proximity of the RLR RIG-I sensor.DepositorAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-Rab27B T23N
Plasmid#89450PurposeExpression of GFP-tagged human Rab27B T23N in mammalian cellsDepositorAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shNRF2 #1
Plasmid#136584PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorAvailable SinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 DOX off blast NFS1
Plasmid#160801PurposeExpress Dox repressible NFS1DepositorInsertNFS1 (NFS1 Human)
UseLentiviralAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pC1-oROS-HT-CaaX
Plasmid#216417PurposeTargeting of the chemigenetic, fluorescent peroxide sensor oROS-HT to the intracellular site of cell membranes.DepositorInsertoROS-HT-CaaX
ExpressionMammalianPromoterCMVAvailable SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBabe JUND-HA neo
Plasmid#58489Purposemammalian expression of human JUNDDepositorAvailable SinceMay 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCS2 LRP6-eGFP
Plasmid#180143Purposeto make movies of LRP6 vesiclesDepositorAvailable SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
U6-DNMT1-hSynapsin-PE2-Nterminal-P2A-EGFP-KASH-lenti
Plasmid#135955PurposeNeuronal expression of N-terminal intein-split prime editor v2 (PE2) with EGFP-KASH marker and U6-mDNMT1 cassette. This plasmid is used by PE2, PE3, and PE3bDepositorInsertPrime editor v2 (PE2) N-terminal
UseLentiviralExpressionMammalianPromoterhSynapsinAvailable SinceJan. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
P-rTetO-EGFP-T2A-RPL22-3xHA
Plasmid#170326PurposeTetracycline-inducible expression of HA and EGFP tagged RPL22DepositorAvailable SinceMay 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRN120
Plasmid#160696PurposeBeYDV viral replicon on T-DNA backbone expressing Firefly Luc+, CmYLCV::STM::35S terminator, Nos::WUS2::PinII terminatorDepositorInsertsCmYLCV::Luc+::AtHSP
Nos::WUS2::PinII
AtUbi10::STM::35S
UseLuciferase; Gemini viral replicon, plant developmā¦PromoterAtUbi10, CmYLCV, and NosAvailable SinceNov. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
CMV-CASANOVA
Plasmid#113035PurposeCASANOVA (AcrIIA4-LOV2 hybrid) expression in mammalian cells; enables optogenetic control of SpyCas9DepositorInsertCASANOVA (for CRISPR/Cas9 activity switching via a novel optogenetic variant of AcrIIA4)
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only