We narrowed to 4,353 results for: erf
-
Plasmid#125901PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProA18Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
5_pAAV-ProA9-CatCh-GFP-WPRE
Plasmid#125893PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProA9Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
214_pAAV-ProD22-CatCh-GFP-WPRE
Plasmid#125998PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProD22Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
159_pAAV-ProD3-CatCh-GFP-WPRE
Plasmid#125979PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProD3Available SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
UseTagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-SLC[∆2-83]-His+MFN2-Strep (SB259)
Plasmid#227608PurposeInducible coexpression of His-tagged SLC25A46 in its N-terminal region (∆2-83) and Strep-tagged MFN2 in Pichia pastorisDepositorUseTags10xHis and Twin-StrepTagExpressionYeastMutationaa 2-83 deletedPromoterAOX1Available SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-SLC-His+MFN2-Strep (SB255)
Plasmid#227604PurposeInducible coexpression of His-tagged SLC25A46 and Strep-tagged MFN2 in Pichia pastorisDepositorUseTags10xHis and Twin-StrepTagExpressionYeastMutationPromoterAOX1Available SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-STING L373A with IRSp53 pLxIS
Plasmid#221283PurposeExpression of STING L373A with IRSp53 pLxIS (RLL361NLV) in mammalian cells by retroviral transductionDepositorUseRetroviralTags3xFLAG-4xFKBPExpressionMutationPromoterAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-IRSp53 with STING pLxIS
Plasmid#221281PurposeExpression of IRSp53 with STING pLxIS (NLV265RLL) in mammalian cells by retroviral transductionDepositorUseRetroviralTags3xFLAG-4xFKBPExpressionMutationPromoterAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-STING with IRSp53 pLxIS
Plasmid#221282PurposeExpression of STING with IRSp53 pLxIS (RLL361NLV) in mammalian cells by retroviral transductionDepositorUseRetroviralTags3xFLAG-4xFKBPExpressionMutationPromoterAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pInducer 21-3xFlag-hMEFV-F479L
Plasmid#195477PurposepInducer21 plasmid containing the human MEFV gene with the F479L mutation (associated with Familial Mediterranean Fever) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationchanged phenylalanine 479 to leucinePromoterAvailable SinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pInducer 21-3xFlag-hMEFV-ΔPYD
Plasmid#195478PurposepInducer21 plasmid containing the human MEFV gene with a deletion of residues 1 - 92 (the resulting pyrin protein lacks the PYD domain) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationdeletion of residues 1-92 of pyrin (the PYD domai…PromoterAvailable SinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pInducer21-3xFlag-hMEFV-Q426R
Plasmid#195475PurposepInducer21 plasmid containing the human MEFV gene with the Q426R mutation (associated with Familial Mediterranean Fever) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationchanged glutamine 426 to argininePromoterAvailable SinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pInducer 21-3xFlag-hMEFV-S580X
Plasmid#195474PurposepInducer21 plasmid containing the human MEFV gene with the S580X mutation (stop codon leading to the truncation of the B30.2 domain of the pyrin protein) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationchanged S580 to a stop codonPromoterAvailable SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
83_pAAV-ProC14-CatCh-GFP-WPRE
Plasmid#125949PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProC14Available SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
82_pAAV-ProC13-CatCh-GFP-WPRE
Plasmid#125948PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProC13Available SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
VII_pAAV-ProB8-GFP-WPRE
Plasmid#125928PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGFP
UseAAVTagsExpressionMutationPromoterProB8Available SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
IV_pAAV-ProB6-CatCh-GFP-WPRE
Plasmid#125926PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProB6Available SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
II_pAAV-ProB5-CatCh-GFP-WPRE
Plasmid#125925PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProB5Available SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
76_pAAV-ProA25-CatCh-GFP-WPRE
Plasmid#125908PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVTagsExpressionMutationPromoterProA25Available SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only