We narrowed to 120,297 results for: CIL
-
Plasmid#59695PurposeContains histone modification interacting domain (CBX7 Chromo)DepositorAvailable SinceSept. 5, 2014AvailabilityAcademic Institutions and Nonprofits only
-
pDONRG_P4-P1R:MUM4_0.3Pro_35S
Plasmid#128558PurposeGateway (Invitrogen) promoter clone (pDONRG_P4-P1R) containing a 307 bp MUM4 (At1g53500) promoter fragment fused to the 54 bp 35S minimal promoter sequence, for use in Three-way Gateway cloningDepositorTypeEmpty backboneUseGateway promoter entry clonePromoterMUM4 core promoter with 35S enhancerAvailable SinceSept. 25, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pU-eCFP
Plasmid#176557PurposeExpression of eCFP for auxotrophic selection in the absence of uracilDepositorInserteCFP
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU-mRuby2
Plasmid#176549PurposeExpression of mRuby2 for auxotrophic selection in the absence of uracilDepositorInsertyomRuby2
ExpressionYeastPromoterTDH1(GAP)Available SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ292 (AaCas12b)-D570A-TV-MS2-TV
Plasmid#136381PurposeCRISPRa Gateway entry clone for catalytically dead AaCas12b (D570A) fused with TV activation system, followed by T2A and MCP-TV fusion proteinDepositorInsertAaCas12b (D570A)-TV-T2A-MCP-TV
UseCRISPRExpressionPlantMutationD570AAvailable SinceFeb. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDsRed2-C1-Ahi1
Plasmid#30495DepositorAvailable SinceJune 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC1-Intu
Plasmid#65430PurposeFor mammalian expression of EGFP-mouse InturnedDepositorAvailable SinceJune 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-M.Mus.1
Plasmid#196681PurposeRep/Cap plasmid for the production of M.Mus.1, an AAV capsid with CNS tropism in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationWVLPSGG insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MDV1B
Plasmid#196680PurposeRep/Cap plasmid for the production of MDV1B, an AAV capsid with CNS tropism in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationKTVGTVY insert between amino acids 588 and 589 of…Promoterp41Available SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
R4pGWB401+Citrine
Plasmid#128432PurposeModified R4pGWB401 three way Gateway destination vector (Nakagawa et al. 2008) that enables C-terminal fusion of Citrine, a dimeric acid stable yellow fluorescent protein.DepositorTypeEmpty backboneUseGateway destination vectorTagsCitrine, yellow fluorescence proteinExpressionPlantAvailable SinceOct. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJ02B2Gm:Rm_AF
Plasmid#66061PurposeMoClo Device: FACS Standard Color Controls - High GFP (first unit) & RFP (second unit) expression cassette - Ampicillin plasmid [A:J23102:B:BCD2:C:E0040m:D:B0015:E:J23102:B:BCD2:C:E1010m:D:B0015:F]DepositorInsertFACS Controls
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJ02B2Rm:Gm_AF
Plasmid#66062PurposeMoClo Device: FACS Standard Color Controls - High RFP (first unit) & GFP (second unit) expression cassette - Ampicillin plasmid [A:J23102:B:BCD2:C:E1010m:D:B0015:E:J23102:B:BCD2:C:E0040m:D:B0015:F]DepositorInsertFACS Controls
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 PAK5 S573N
Plasmid#60538PurposeDonor vector for human Pak5 S573N mutantDepositorAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 PAK5 T538N
Plasmid#60537PurposeDonor vector for human Pak5 T538N mutantDepositorAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFNC-5
Plasmid#233297PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. TcR, easily curable via sucrose counterselection.DepositorInsertsBxbI phage integrase
sacB
ExpressionBacterialPromoterPEM7 and unknownAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFNC-6
Plasmid#227669PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. GmR, easily curable via sucrose counterselection.DepositorInsertsBxbI phage integrase
sacB
ExpressionBacterialPromoterPEM7Available SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28:LanIII-6
Plasmid#225076PurposeExpresses precursor peptide and lanthipeptide synthetase from LanIII-6 (FAST-RiPPs) in E. coliDepositorInsertLanA(A) (LanIII-6)
TagsHis6ExpressionBacterialMutationWTPromoterT7Available SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-IFT57
Plasmid#218728PurposeExpresses N-terminally EGFP-tagged IFT57 in mammalian cellsDepositorAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRA1SEGFPTcIfm
Plasmid#193777PurposeCassette 1: Expresses EGFP under the control of PR promoter, Cassette 2: Expresses frame-shifted CI under the control of PLTetO-1 promoter, pUC origin of replication, Ampicillin selectionDepositorInsertEGFP and frame-shifted CI in opposite orientation, controlled by separate promoters and terminators
UseSynthetic BiologyExpressionBacterialPromoterPR promoter and PLTetO-1Available SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only