We narrowed to 4,689 results for: crispr c plasmids
-
Plasmid#171333PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertSpCas9 (for fusion)
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFTK057
Plasmid#171329PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertdSpCas9(m4)-VPR-NLS
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_YES_i2
Plasmid#231419PurposeThis YES-gate plasmid expresses dCas9 from a constitutive promoter, GFP from a promoter repressible by sgRNA-Y, and sgRNA-Y repressible by sgRNA-2.DepositorInsertsdCas9
GFP
sgRNA-Y
UseSynthetic BiologyAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
plenti-As-Cas12a-2xNLS
Plasmid#155047PurposeLentiviral vector expressing human codon-optimized _C-terminal Myc-tagged _Acidaminococcus sp. BV3L6 (As)-Cas12a nuclease with N- and C-terminal NLS and Neomycin/G418/Geneticin resistance from EF-1alpha promoterDepositorInsertAsCas12a
UseCRISPR and LentiviralTagsNucleoplasmin NLS, Myc-tag and SV40 NLSExpressionMammalianPromoterEF-1aAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
plenti-Lb-Cas12a-2xNLS
Plasmid#155046PurposeLentiviral vector expressing human codon-optimized _C-terminal Myc-tagged Lachnospiraceae bacterium (Lb)-Cas12a nuclease with N- and C-terminal NLS and Neomycin/G418/Geneticin resistance from EF-1alpha promoterDepositorInsertLbCas12a
UseCRISPR and LentiviralTagsNucleoplasmin NLS, Myc-tag and SV40 NLSExpressionMammalianPromoterEF-1aAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPD0039_CROP-seq-CAR-Puro
Plasmid#242532PurposeCAR T screeningDepositorInsertCD19-BB CAR (CD19 Human)
UseLentiviralAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CR029
Plasmid#234041Purposeexpresses evoCDA1 BE4max base editor in a human T cell optimized lentiviral transfer plasmidDepositorInsertevoCDA1-Cas9(D10A)-P2A-blast
UseLentiviralTagsblastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CR102
Plasmid#234043Purposeexpresses ABE8e(V106W) - SpG Cas9 base editor in a human T cell optimized lentiviral transfer plasmidDepositorInsertTadA8e(V106W)-SpG-Cas9(D10A)-P2A-blast
UseLentiviralAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330_NANOS3_cterm
Plasmid#222904PurposeCas9/sgRNA plasmid for targeting NANOS3DepositorInsertCas9, NANOS3 sgRNA (NANOS3 Synthetic, Human)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPD0035_CROPseq-CAR-Puro_CD19-28z
Plasmid#242983PurposeCD19-28z FMC63 CARDepositorInsertCD19-28z FMC63 CAR (CD19 Human)
UseLentiviralAvailable SinceNov. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER dCas9-TET1CDMut
Plasmid#101920PurposeThe dCas9-TET1CDMut fusion protein is cloned into the pINDUCER lentiviral backbone (Addgene plasmid# 46948). The TET1 catalytic domain is mutated to abolish catalytic function.DepositorInsertdCas9-TET1CD Mut
UseLentiviralExpressionMammalianMutationMutated TET1 catalytic domainAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgCtrl_EF1a-Puro-T2A-BFP
Plasmid#195500PurposeLentiviral BFP expression vector bearing a sgRNA targeting a randomized human TSS sequenceDepositorInsertsgRNA
UseCRISPR and LentiviralTagsBFP, Puro, and T2AExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti_CMV_Puro_SFB_GNB1L
Plasmid#224381PurposeLenti plasmid for generating GNB1L expressing stable cell linesDepositorInsertGNB1L (GNB1L Human)
ExpressionBacterial and MammalianAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-FOXL2-cterm
Plasmid#192893PurposeExpresses Cas9 and sgRNA targeting the C-terminus region of FOXL2DepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Basic-Rab18-sfGFP(N) HDR template
Plasmid#129415PurposeHDR tempalte for tagging of endogenous human RAB18 N-terminus with sfGFPDepositorInsertRAB18 HDR template (RAB18 Human)
UseCRISPR and TALEN; Endogenous tagging hdr templateTagssfGFPExpressionMammalianAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-3xsgRNA_Opn1mw-RHO-Cas9N-IntN-polyA
Plasmid#165450PurposeExpress N-terminal part of split dCas9-VPR and 3 sgRNAs targeting murine Opn1mw promoterDepositorInsertsdCas9N-IntN
3x Opn1mw promoter-targeting sgRNAs
UseAAV and CRISPRExpressionMammalianPromoterU6 and short human rhodopsin promoterAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CR033
Plasmid#234042Purposeexpresses ABE8e(V106W) base editor in a human T cell optimized lentiviral transfer plasmidDepositorInsertTadA8e(V106W)-Cas9(D10A)-P2A-blast
UseLentiviralAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease-Puro
Plasmid#171992PurposeDelivers all prime editing nuclease components in a single, puromycin selectable plasmidDepositorInsertCbH-Cas9-RT-T2A-Puro, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
ExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease-GFP
Plasmid#171994PurposeDelivers all prime editing nuclease components in a single, GFP selectable plasmidDepositorInsertCbH-Cas9-RT-T2A-GFP, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
ExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-GfABC1D-SaCas9-WPRE3-pA
Plasmid#203540PurposeSaCas9 expression in astrocytesDepositorInsertSaCas9
UseAAVExpressionMammalianAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
hSyn1-AsCpf1(RR)
Plasmid#109325PurposeAAV vector expressing AsCpf1 (RR variant)DepositorInserthAsCpf1(RR)
UseAAVTagsHA and NLSMutationS542R/K607RPromoterhSyn1Available SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-Scaffold-cTNT-SaCas9-HA-OLLAS
Plasmid#209781PurposeExpresses SaCas9 by the specific cTNT promoter and sgRNA scaffold by U6 promoterDepositorInsertcTNT
UseAAVTagsHA and OLLASPromotercTNTAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-crRNA(TBK1)
Plasmid#109322PurposeAAV vector expressing crRNA for AsCpf1 (RR variant) targeting human TBK1DepositorAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + M-AAT target
Plasmid#86008Purposelenti reporter plasmid with M-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
M-AAT target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgMap3K12(1)-U6-sgMap3K12(2)-hSyn1-mCherry
Plasmid#208835PurposeKnockout of Map3K12 (DLK) using tandem sgRNAs, expresses mCherry under the hSyn1 promoterDepositorInsertmCherry
UseAAV and CRISPRExpressionBacterial and MammalianPromoterhSyn1Available SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgMap3K13(1)-U6-sgMap3K13(2)-hSyn1-mCherry
Plasmid#208836PurposeKnockout of Map3K13 (LZK) using tandem sgRNAs, expresses mCherry under the hSyn1 promoterDepositorInsertmCherry
UseAAV and CRISPRExpressionBacterial and MammalianPromoterhSyn1Available SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_DAZL_cterm2
Plasmid#222919PurposeCas9/sgRNA plasmid for targeting DAZLDepositorInsertCas9, DAZL sgRNA 2 (DAZL Synthetic, Human)
UseCRISPRAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_DAZL_cterm3
Plasmid#222920PurposeCas9/sgRNA plasmid for targeting DAZLDepositorInsertCas9, DAZL sgRNA 3 (DAZL Synthetic, Human)
UseCRISPRAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_TFAP2C_cterm
Plasmid#222916PurposeCas9/sgRNA plasmid for targeting TFAP2CDepositorInsertCas9, TFAP2C sgRNA (TFAP2C Synthetic, Human)
UseCRISPRAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only