-
Plasmid#186969PurposePiggyBac vector encoding mouse Dnmt3a2 with Ires2-mCherry fluorescent marker for expression in mammalian cells.DepositorInsertDnmt3a2 (Dnmt3a Mouse, Synthetic)
UsePiggybacTagsFlagExpressionMammalianMutationIsoform 2 (residues 220–908)PromoterCAGAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-CnVA
Plasmid#24587DepositorInsertGateway(TM) cassette
UseLentiviralTagsVAExpressionMammalianMutationPromoterAvailable sinceJuly 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcdna DSG-2 TS
Plasmid#89465PurposeDSG-2 tension sensor, using TSmod inserted in human DSG-2DepositorInsertdesmoglein-2 (DSG2 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:MS2:EDLL:Tnos (GB1738)
Plasmid#160622PurposeTU for the constitutive expression of the MS2 coat protein fused on Ct to the activation domain EDLLDepositorInsertP35s_MS2:EDLL_Tnos
UseTagsExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable sinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 a22-end_I132S-S212N-D231G
Plasmid#113953Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
UseTagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationdelete N-terminal 21 residues, I132S, S212N, and …PromotercmvAvailable sinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJK-caCas9-NatMX-Neut5L-Ade2 drive
Plasmid#89577PurposecaCas9 integrating vector into the Neut5L locus with gene drive for targeting Ade2 locusDepositorInsertAde2 gene drive
UseSynthetic BiologyTagsExpressionYeastMutationPromoterAvailable sinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
KZ801: pMAGIC (L1-R5) hU6::SaCas9 gRNA scaffold; EF1a promoter
Plasmid#121814PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold and EF1a promoter for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA1 C64Y
Plasmid#139326PurposePlasmid expressing a sgRNA to introduce BRCA1 C64Y using base editingDepositorInsertsgRNA to insert BRCA1 C64Y using base editing
UseTagsExpressionMammalianMutationPromoterU6Available sinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA1 E638K
Plasmid#139327PurposePlasmid expressing a sgRNA to introduce BRCA1 E638K using base editingDepositorInsertsgRNA to insert BRCA1 E638K using base editing
UseTagsExpressionMammalianMutationPromoterU6Available sinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pST1374-dCas9-GCN4
Plasmid#113026PurposeExpresses dCas9-GCN4 in mammalian cellsDepositorInsertdCas9-GCN4 (GCN4 S. pyogenes, Budding Yeast)
UseTagsExpressionMammalianMutationD10A, H840A, N863APromoterCMVAvailable sinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
nLuc_AP4_TEVs_P3mS
Plasmid#119299PurposeExpresses N-terminus of split luciferase fused to antiparallel coiled-coil AP4 connected with autoinhibitory coil P3mS and TEV cleavage site in antiparallel harpin linker/for SPOC logicDepositorInsertsplit nLuc fused to antiparallel Coiled-coil AP4 connected with P3 via TEV cleavable linker
UseLuciferaseTagsMyc tagExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-CADPS KI
Plasmid#131482PurposeEndogenous tagging of CAPS1: N-terminal (amino acid position: S39)DepositorInsertgRNA and GFP donor (Cadps Rat)
UseTagsExpressionMammalianMutationPromoterU6 and CbhAvailable sinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-sTagRFP-TUBA1B
Plasmid#207768PurposeDonor template for Blast-2A-sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Blast-sTagRFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGL3-MTS-CCDB-N136-RsDddA-A-UGI-PURO
Plasmid#205463PurposeA backbone containing a RsDddA fragment A for constructing mitochondria-targeted RsDdCBE expression plasmidDepositorInsertMTS; N136; ccdb; RsDddA-A; UGI
UseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-MTS-CCDB-N136-RsDddA-C-UGI-PURO
Plasmid#205465PurposeA backbone containing a RsDddA fragment C for constructing mitochondria-targeted RsDdCBE expression plasmidDepositorInsertMTS; N136; ccdb; RsDddA-C; UGI
UseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-dCas9-mD3A
Plasmid#78257PurposeExpresses dead Cas9 (dCas9) fused to inactive DNMT3A catalytic domain (CD) under the control of the CMV promoterDepositorInsertDNMT3A CD aa 598-912 (DNMT3A Human)
UseCRISPRTagsFlag epitope tagExpressionMammalianMutationE756APromoterpCMVAvailable sinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 a22-end_I132S-S212N
Plasmid#113952Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
UseTagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationdelete N-terminal 21 residues, I132S and S212N su…PromotercmvAvailable sinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [M1_n-1] (GB1210)
Plasmid#75411PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_n-1]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (2-part multiplexing)DepositorInserttRNA-gRNA position [M1_n-1]
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-CCre-MBP4-WPRE
Plasmid#193919PurposeExpresses one of the components of Cre-DOR_N5C4 (RFP-dependent Cre)DepositorInsertCCre-MBP4
UseAAV, Affinity Reagent/ Antibody, Cre/Lox, and Syn…TagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-NCre-MBP5-WPRE
Plasmid#193918PurposeExpresses one of the components of Cre-DOR_N5C4 (RFP-dependent Cre)DepositorInsertNCre-MBP5
UseAAV, Affinity Reagent/ Antibody, Cre/Lox, and Syn…TagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAC8_PH-GST-Nter-GWs-Lox (VE5586)
Plasmid#163766PurposeTransfer vector for gene expression to generate recombinant baculoviruses by homologous recombination. Contains expression cassette with an N-ter GST tag under the pH promoter.DepositorInsertN-terminal GST tag
UseTagsGST TagExpressionInsectMutationPromoterPHAvailable sinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.FAPdL5-POST-T2A-dTomato.FLEX.WPRE.SV40
Plasmid#105982PurposeThis AAV plasmid in the presence of Cre recombinase expresses an extracellular dL5 FAP fused to the neuroligin-1 cytoplasmic domain for targeting to the synapse with a cell fill dTomato.DepositorInsertFLEX-FAPdL5-POST-T2A-dTomato.FLEX
UseAAV and Cre/LoxTagsFAPdL5-POST, T2A-dTomato, and mycExpressionMammalianMutationPromoterhuman synapsin 1Available sinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
AP4mS_PPVs_P3_cLuc
Plasmid#119300PurposeExpresses C-terminus of split luciferase fused to P3 coil, PPVs cleavable linker and autoinhibitory coil AP4/for split protease-cleavable orthogonal Coiled-coil (SPOC) logicDepositorInsertsplit cLuc fused to P3coil-PPV cleavage site and autoinhibitory coil AP4mS
UseLuciferaseTagsExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER21-puro_TAOK1
Plasmid#209777Purposedoxycycline-inducible expression of TAOK1DepositorInsertTAOK1 (TAOK1 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationPromoterAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB009
Plasmid#119707PurposeTranscriptional Unit (TU) for geneticin (G418) resistance in fungi obtained by combining FB001+FB005+FB002 into pDGB3alpha2. According to FungalBraid/GoldenBraid modular DNA assembly for ATMTDepositorInsertPtrpC::nptII::Ttub
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
KO101: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS-Dnmt3a3L
Plasmid#121833PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) fused to the Dnmt3a-3L DNA methyltransferase for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7)/Dnmt3a-3L (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Hyg-mEGFP-pp4640
Plasmid#191846PurposeExpresses Salmon Alphavirus polyprotein with mEGFP N-terminal fusionDepositorInsertmEGFP-pp4640
UseTagsmEGFPExpressionMammalianMutationmEGFP fusion in Nterminal, some silent point muta…PromoterCMVAvailable sinceNov. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
JG1202: CAG-human dLbCpf1(D832A)-NLS-3xHA-P65
Plasmid#104566PurposeMammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to p65 activation domainDepositorInsertdLbCpf1(D832A)-p65
UseTags3x HA and NLSExpressionMammalianMutationD832APromoterCAGAvailable sinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS511b
Plasmid#87387PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS511b sequence CAGTGTATGCCAGTCAGCCA in yeast chromosome 5.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS511b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Pyr pUAST-HA
Plasmid#69768PurposePyramus (FGF8-like-2) Ligand in P element-based pUAST vector for Gal4-regulated expression in Drosophila.DepositorInsertPyramus (FGF8like-2) (pyr Fly)
UseP element-based puast vector for gal4-regulated e…TagsHA-TagExpressionInsectMutation241T amino acid insertion compared to reference s…Promoterhsp70 promoterAvailable sinceNov. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-hA3A-eBE-Y132D
Plasmid#113429PurposeExpresses hA3A-eBE-Y132D in mammalian cellsDepositorInserthA3A-eBE-Y132D (APOBEC3A S. pyogenes and Bacteriophage PBS2, Human)
UseCRISPRTagsExpressionMammalianMutationhAPOBEC3A_Y132DPromoterCMVAvailable sinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA2 V572I
Plasmid#139321PurposePlasmid expressing a sgRNA to introduce BRCA2 V572I using base editingDepositorInsertsgRNA to insert BRCA2 V572I using base editing
UseTagsExpressionMammalianMutationPromoterU6Available sinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJK-caCas9-NatMX-Neut5L-Leu2 drive
Plasmid#89578PurposecaCas9 integrating vector into the Neut5L locus with gene drive for targeting Leu2 locusDepositorInsertLeu2 gene drive
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_nV5-TAOK2
Plasmid#173000Purposeconstitutive expression of V5-tagged TAOK2DepositorInsertV5-TAOK2 (TAOK2 Human)
UseTagsV5ExpressionMammalianMutationPromoterAvailable sinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGB SF-35S:Renilla:TNOS-35S:P19:TNOS (GB0160)
Plasmid#75412PurposeModule for the expression of the Renilla Luciferase with the silencing suppressor P19DepositorInsertRenilla / P19
UseLuciferase and Synthetic BiologyTagsExpressionPlantMutationPromoter35SAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p47phox-PX (1-122)
Plasmid#119124PurposeBacterial expression of human phox homology (PX) domain, p47phox-PX (1-122)DepositorInsertp47phox-PX (1-122)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRD398
Plasmid#163105PurposeExpression of mCherry_H-NSdbd in eukaryotes for visualisation of nuclear DNADepositorInsertNLS_mCherry_H-NSdbd_NLS
UseEukaryotic expressionTagsExpressionMammalianMutationPromoterCMV promoter; T7 promoterAvailable sinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLN193 (SSX1p-[mK-Ex1]-[miR1-Mv3 intron]-[mK-Ex2]-BS(Pe))
Plasmid#105210PurposeModule 1 - SSX1 promoter drives self-inhibiting mKate2 expression (Version 3 intron - see PMID: 29056342 for detailed information)DepositorInsertSSX1p-[mK-Ex1]-[miR1-Mv3 intron]-[mK-Ex2]-BS(Pe)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceMarch 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
mPLD1-PX (71-210)
Plasmid#119127PurposeBacterial expression of human phox homology (PX) domain, mPLD1-PX (71-210)DepositorInsertmPLD1-PX (71-210)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceApril 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
SNX12-PX (1-162)
Plasmid#119093PurposeBacterial expression of human phox homology (PX) domain, SNX12-PX (1-162)DepositorInsertSNX12-PX (1-162) (SNX12 Human)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceFeb. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
SNX11-PX (7-167)
Plasmid#119092PurposeBacterial expression of human phox homology (PX) domain, SNX11-PX (7-167)DepositorInsertSNX11-PX (7-167) (SNX11 Human)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceJuly 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGB2Ω2_SF-35s:hCas9:tNos (GB1103)
Plasmid#75400PurposeTranscriptional unit for (human codon optimized) Cas9 plant expression driven by the 35S promoter. Specially conceived to be linked with the TU of the kanamycin resistance gene GB1181.DepositorInserthCas9
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoter35SAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPGK-T7/2-CD44v3 (-cyt)
Plasmid#137813Purposeexpression of CD44 proteins in mammalian cellsDepositorInsertCD44v3 (-cyt) (CD44 Human)
UseTagsGFPExpressionMammalianMutationwithout cytoplasmic region, N280D in the V3 regionPromoterPGKAvailable sinceJune 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-Rac-WT(guide resistant)-2a-mcherry-U6ac-Rac guides
Plasmid#168242Purpose"Rescue Rac expression in neutrophil specific knockout"DepositorInsertRac(guide resistant)-WT
UseZebrafish expressionTagsmcherryExpressionMutationPromoterLyzCAvailable sinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [D1_n-1] (GB1208)
Plasmid#75409PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [D1_n-1]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter (2-part multiplexing)DepositorInserttRNA-gRNA position [D1_n-1]
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLD-hygro-EnVM
Plasmid#24590DepositorInsertGateway(TM) cassette
UseLentiviralTagsVMExpressionMammalianMutationPromoterAvailable sinceJuly 7, 2010AvailabilityAcademic Institutions and Nonprofits only