We narrowed to 14,168 results for: eng
-
Plasmid#191255PurposeBacterial expression plasmids for pH sensitive fluorescent protein LimeDepositorInsertLime
TagsHis tagExpressionBacterialAvailable sinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET51b(+)_HaloTag9
Plasmid#169324PurposeExpression of HaloTag9 in bacterial cellsDepositorInsertHaloTag9
TagsHisExpressionBacterialMutationHaloTag9 = HaloTag7-Q165H-P174RAvailable sinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pZ143-pcDNA3-BvCas12b
Plasmid#122445PurposeExpresses BvCas12b in mammalian cellsDepositorInsertCMV-NLS-BvCas12b-NLS-3xHA
Tags3XHAExpressionMammalianAvailable sinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRE-UBC-HLA-E SCT-T2A-GFP
Plasmid#205461Purposelentiviral plasmid for expression of HLA-E SCTDepositorAvailable sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 sgNRF2-3
Plasmid#186838Purposeknock out NRF2 in mammalian cellsDepositorInsertNrf2 (Nuclear factor-erythroid factor 2-related factor 2) (NFE2L2 Human)
UseCRISPR and LentiviralAvailable sinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJZC638
Plasmid#62283PurposeExpresses MCP-VP64 and dCas9 in Yeast cellsDepositorInsertsMCP-VP64
dCas9
TagsVP64ExpressionYeastMutationNuclease activity has been deactivated by mutatio…PromoterpAdh and pGal10Available sinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSimpleII-U6-tracr-U6-crRNA(OCT4)-NLS-NmCas9-HA-NLS(s)
Plasmid#47870PurposeAll-in-one plasmid targeting human OCT4, cuts roughly ~84bp downstream of stop codon.DepositorPublicationInsertsNmCas9
U6pr-tracrRNA
OCT4 crRNA
UseCRISPRTagsHA and NLSExpressionMammalianAvailable sinceSept. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSUPER.retro-{beta}4 siRNA
Plasmid#16266DepositorAvailable sinceMarch 6, 2008AvailabilityAcademic Institutions and Nonprofits only -
pRSET FLIPglu-3.2mDelta13
Plasmid#13560DepositorInsertFLIPglu F16A S112A Delta13
TagsECFP and EYFPExpressionBacterialMutationF16A, S112A in binding proteinAvailable sinceDec. 15, 2006AvailabilityAcademic Institutions and Nonprofits only -
pWN_U6-TRAC-miniGag-Cas9
Plasmid#228959PurposeminiEDV production plasmid. Expresses the miniGag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter)DepositorInsertminiGag-Cas9
UseCRISPRExpressionMammalianAvailable sinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBAD_His B_QuasAr2
Plasmid#64134PurposeFluorescent reporter of membrane voltage with improved sensitivityDepositorInsertQuasAr2
ExpressionBacterialAvailable sinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBAD_His B_QuasAr1
Plasmid#64135PurposeFluorescent reporter for membrane voltage with improved brightnessDepositorInsertQuasAr1
ExpressionBacterialAvailable sinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
RBD#4L
Plasmid#193021PurposehnRNP C RRM RNA binding domain inserted in between N415 and N416 of Loop 1 of LwaCas13aDepositorInsertCas13a
TagshnRNP C RRMExpressionBacterialAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available sinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHR-SIN-PTEN-WT
Plasmid#30370DepositorAvailable sinceAug. 11, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
DV3 VLPs pVRC8400
Plasmid#63163PurposeDV3 prM-E structural cassette in pVRC8400DepositorInsertDV3 prM-E
ExpressionMammalianAvailable sinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Caspase 12
Plasmid#35574DepositorInsertCaspase 12 (Casp12 Mouse)
ExpressionMammalianAvailable sinceMay 6, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBLO1808_arC9_2xNLS_human
Plasmid#74491PurposeHuman codon optimized plasmid to express arC9 t2a mCherry w/2xNLS and a sgRNADepositorInsertarC9
Tagst2a mCherryExpressionMammalianAvailable sinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
scFv-GCN4-DNMT3a(R887E)-DNMT3l
Plasmid#154141PurposeExpresses a higher specificity variant of scFv-GCN4-DNMT3a-DNMT3l, contains R887E mutation in DNMT3a. To be used with the dCas9-SunTag system for targeted DNA methylation.DepositorInsertscFv-GCN4, DNMT3a (catalytic domain), DNMT3l (C-terminal part), sfGFP
TagsHA and sfGFPExpressionMammalianMutationR887EPromoterSFFVAvailable sinceOct. 19, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSF3-microID
Plasmid#172880Purposeexpresses microID in mammalian cells with the tet-on or tet-off systemDepositorInsertmicroID
UseLuciferase and Retroviral; To be used in a tet-on…TagsmycExpressionMammalianMutationfragment ([aa2-171]) of aquifex aeolicus BirA wit…PromoterTRE-cmvAvailable sinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only