We narrowed to 8,765 results for: PAN
-
Plasmid#231413PurposeM13 phagemid constitutively expressing sgRNA-A0. sgRNA-A0 is a dummy 20-nt sequence, containing a Golden Gate cloning site (BsaI).DepositorInsertsgRNA-A0
UseSynthetic BiologyAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_YES_i2
Plasmid#231419PurposeThis YES-gate plasmid expresses dCas9 from a constitutive promoter, GFP from a promoter repressible by sgRNA-Y, and sgRNA-Y repressible by sgRNA-2.DepositorInsertsdCas9
GFP
sgRNA-Y
UseSynthetic BiologyAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_NOT_i1
Plasmid#231416PurposeThis NOT-gate plasmid expresses dCas9 from a constitutive promoter, and GFP from a promoter repressible by sgRNA-1.DepositorInsertsdCas9
GFP
UseSynthetic BiologyAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDB_268
Plasmid#231112PurposeSpG-Cas9DepositorInsertCas9-SpG
UseCRISPR and LentiviralAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA516
Plasmid#231118PurposeFragmid fragment: (2A Selection) CBE activity-based selection intronDepositorInsertPuroN'-intron-PuroC'
UseCRISPRExpressionBacterialAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA566
Plasmid#231115PurposeFragmid fragment: (guide cassette) ABE activity-based selection cloningDepositorTypeEmpty backboneUseCRISPRExpressionBacterialAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA568
Plasmid#231117PurposeFragmid fragment: (guide cassette) CBE activity-based selection cloningDepositorTypeEmpty backboneUseCRISPRExpressionBacterialAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA509
Plasmid#231116PurposeFragmid fragment: (2A Selection) ABE activity-based selection intronDepositorInsertPuroN'-intron-PuroC'
UseCRISPRExpressionBacterialAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO_eGFP-pScaC-MTS
Plasmid#228827PurposeFor the expression of the passenger domain of the Orientia tsutsugamushi protein ScaC C-terminally fused to a mitochondrial targeting sequence in HeLa Flp-In cellsDepositorInsertScaC
TagsMTS and eGFPExpressionMammalianMutationaa 33-223Available SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1_Strep-Psc-BICD2
Plasmid#228829PurposeInsect cell expression of BICD2DepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-MhCINS-6xHis
Plasmid#194304PurposeBacterial expression of MhCINS protein with a C terminal His-tag and transit peptide removed at N terminalDepositorInsertMhCINS
Tags6xHisExpressionBacterialPromoterT7Available SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pLei-sfGFP-D134*
Plasmid#191110PurposeAn E. coli sfGFP reporter with one TAG at position 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*
Plasmid#191111PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM245
Plasmid#226889Purpose6xHis-PSP-GS-PANN(75-150)-(5aaGS)-Msp1(36-362)DepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEC2796 (pSpy0C4)
Plasmid#220280Purposeintegrative plasmid for heterologous gene expression in S. pyogenes SF370, integrates into the sagB locus via homologous recombinationDepositorTypeEmpty backboneExpressionBacterialAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMK454 (dTAG-BSD)
Plasmid#214384PurposedTAG for C-terminal taggingDepositorInsertdTAG-BSD
UseCRISPRExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSM045
Plasmid#217399PurposeKmR, pBTRcK broad host range vector with BTE1(C12-specific fatty acid thioesterase codon-optimised for C. necator) under PtrcDepositorInsertBTE1
ExpressionBacterialPromoterPTrcAvailable SinceJuly 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSM046
Plasmid#217400PurposeKmR, pBTRcK broad host range vector with BTE2(C12-specific fatty acid thioesterase codon-optimised for C. necator) under PtrcDepositorInsertBTE2
UseSynthetic BiologyExpressionBacterialPromoterPTrcAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS161
Plasmid#215683PurposeGuide only plasmid targeting chrIII split hygromycinR landing padDepositorInsertU6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only