We narrowed to 7,632 results for: ALP
-
Plasmid#162785PurposeSARS-CoV-2 S protein receptor binding domain (RBD) expression in mammalian cellsDepositorInsertSARS-CoV-2 S protein receptor binding domain (RBD) (S Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2))
Tags10xHis, c-myc, and hTPA leaderExpressionMammalianPromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PHKA1
Plasmid#23471DepositorInsertPHKA1 (PHKA1 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-CSNK1A1L
Plasmid#23784DepositorInsertCSNK1A1L (CSNK1A1L Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
L4385 dsRedExpress2 reporter, IL-10Rb NTEVp, IL-10Ra CTEVp in PiggyBac Transposon Vector
Plasmid#244186PurposePiggyBac transposon vector for expression of dsRedExpress2 under synTF promoter; constitutive expression of IL-10Rb NTEVp chain, IL-10Ra CTEVp chain, and mNeonGreen-P2A-PuroR selection markerDepositorInsertdsRedExpress2 under synTF responsive promoter; IL-10Rb NTEVp chain with human CD8a SS; IL-10Ra CTEVp chain; mNeonGreen-P2A-PuroR (CD8A Synthetic, Human)
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationNTEVp_75S, CTEVp_190KPromoterhEF1aAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/UBC-mVenus-P2A-NRASG12V
Plasmid#236074PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Ubc promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidMutationG12VPromoterUbcAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/PGK-mVenus-P2A-NRASG12V
Plasmid#236073PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Pgk promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidMutationG12VPromoterPGKAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP Cav2.2 human HAgHA-plus exon 18a - Short-Cterm - Arginine -in pcDNA3
Plasmid#198915PurposeN-terminal GFP tagged, exofacial HAgHA tag in Domain II, contains exon 18a, Short form of alternatively spliced C-teminus, SNP rs2278973 variant Arginine, in pcDNA3 vectorDepositorInsertCav2.2 (CACNA1B Human)
TagsN-terminal GFP, internal double HAExpressionMammalianMutationsnp rs2278973 ArgininePromoterCMVAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
rag2:CYP27B1_CE_pISceI
Plasmid#223028PurposeExpress CYP27B1 gene in mesenchymal lineage of Zebrafish.DepositorAvailable SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0_shRNAHsCavin1_MmCavin1_EGFP
Plasmid#229689PurposeLentiviral expression of shRNA targeting Cavin1 + reconstitution of mouse Cavin1 (Cavin1 rescue)DepositorUseLentiviralTagsEGFPPromoterLTR viral promoterAvailable SinceJan. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-scFVDnmt3AL_bGHpA
Plasmid#177348PurposeAAV expression of a fusion protein with scFV, catalytic domain of Dnmt3a and C terminal domain of Dnmt3l from Synapisin promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsC-terminal domain of mouse Dnmt3l (194–415 aa), P…ExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterhuman SynapsineAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-scFVDnmt3AL_bGHpA
Plasmid#177354PurposeAAV expression of a fusion protein with scFV, catalytic domain of Dnmt3a and C terminal domain of Dnmt3l from doxycycine-inducible promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsC-terminal domain of mouse Dnmt3l (194–415 aa), P…ExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterTetracycline-dependent promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-scFVDnmt3A_bGHpA
Plasmid#177355PurposeAAV expression of scFV-fused catalytic domain of Dnmt3a from doxycycine-inducible promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsmyc and scFVExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterTetracycline-dependent promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHIV(T9)-DERA-sgresis
Plasmid#222622PurposeLentiviral vector that expresses sgRNA resistant DERA in mammalian cellsDepositorAvailable SinceAug. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
SHIP2-C1
Plasmid#214905Purposeexpression of the truncated variants of the SHIP2 that retains second proline-rich domain and C-terminal sterile alpha motifDepositorInserthuman SHIP2 aa 740-1258 (INPPL1 Human)
TagsV5/HisExpressionMammalianMutationdelta 1-739aaPromoterCMVAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-837_NY-ESO-1_TCR_tFAS
Plasmid#207500PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInserttFAS, NY-ESO-1_TCR (FAS Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP Cav2.2 HA EI,II,III,IVA (E314A, E664A, E1370A, E1658A) pcDNA3
Plasmid#206093PurposeCav2.2 calcium channel with a N-terminal GFP tag, exofacial double HA tag in domain II and mutations in the P loop of Domains I, II, III and IV which abolish trafficking to the cell surfaceDepositorInsertcacna1b (CACNA1B Rabbit)
TagsGFPExpressionMammalianMutationE314A, E664A, E1370A, E1658APromoterCMVAvailable SinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cav2.2 HA EI,II,III,IVA (E314A, E664A, E1370A, E1658A) pCAGGS
Plasmid#206098Purposeexpression of rabbit Cav2.2 calcium channel with an exofacial double HA tag in domain II and mutations in the P loop of Domains I, II, III and IV which abolish trafficking to the cell surfaceDepositorInsertcacna1b (CACNA1B Rabbit)
ExpressionMammalianMutationE314A, E664A, E1370A, E1658APromoterCMV/B-actinAvailable SinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Brevican scFv [N294A/6]
Plasmid#206772PurposeMammalian Expression of Brevican scFV. Derived from hybridoma N294A/6 scFv.DepositorAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FAS-COMP5AP-AviTag-9xHis
Plasmid#157106PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-IL1R1-COMP5AP-AviTag-9xHis
Plasmid#157320PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FASLG-COMP5AP-AviTag-9xHis
Plasmid#157143PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-CD8A-COMP5AP-AviTag-9xHis
Plasmid#157118PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-VSIR-COMP5AP-AviTag-9xHis
Plasmid#157120PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FCAR-Fc(DAPA)-AviTag-6xHis
Plasmid#156619PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertFCAR (FCAR Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-ULBP2-Fc(DAPA)-AviTag-6xHis
Plasmid#156596PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertULBP2 (ULBP2 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-Brevican [N294A/6]
Plasmid#190309PurposeMammalian Expression Plasmid of anti-Brevican (Rat). Derived from hybridoma N294A/6.DepositorInsertanti-Brevican (Rattus norvegicus) recombinant Mouse monoclonal antibody (Bcan Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-CD8A-Fc(DAPA)-AviTag-6xHis
Plasmid#156553PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertCD8A (CD8A Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceAug. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIG-720 CTLA4-GFP R75W
Plasmid#186125PurposeCTLA4 gene knockin with mutationDepositorAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTR-337 pUC19-tNGFR-P2A-CTLA4 N
Plasmid#186054PurposeKnockin of truncated NGFR to target geneDepositorAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291D
Plasmid#115200PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293D
Plasmid#115201PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291D/S293D
Plasmid#115202PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291D/S293D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291D/S293D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMH005_phiC31_neo-core-5xTetO-pEF-H2B-mCitrine-core-pRSV-H2B-mCherry
Plasmid#179433PurposeDual fluorescent reporter construct with double core HS4 insulator, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertcoreHS4-TRE-cit-coreHS4-mch (DC)
ExpressionMammalianPromoterpEF alpha, pRSVAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSL008_phiC31_neo-5xTetO-pEF-H2B-mCitrine-5kb,lambda-pRSV-H2B-mCherry
Plasmid#179426PurposeDual fluorescent reporter construct with 5kb lambda spacer, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertTRE-cit-5kb-mch
ExpressionMammalianPromoterpEF alpha, pRSVAvailable SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMH010_phiC31_neo-5xTetO-pEF-H2B-mCitrine-1.2kb,lambda-pRSV-H2B-mCherry
Plasmid#179427PurposeDual fluorescent reporter construct with 1.2kb lambda spacer, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertTRE-cit-1.2kb-mch
ExpressionMammalianPromoterpEF alpha, pRSVAvailable SinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVE-FH-Dnd1-IN
Plasmid#70072Purpose2nd gen lentiviral vector. Cre-removable and tet/dox-controllable expression of FLAG-HA-tagged murine Dnd1 in mammalian cells.DepositorInsertDnd1 (Dnd1 Mouse)
UseCre/Lox and LentiviralTagsFLAG and HAExpressionMammalianPromoterEF1alphaAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_NRAS_p.Y64D
Plasmid#81666PurposeGateway Donor vector containing NRAS, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_TNF_p.S157R
Plasmid#81344PurposeGateway Donor vector containing TNF , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET-Duet-ECHA(37-763) K351R-FLAG (no His-tag)
Plasmid#96888Purposeexpresses-flag tagged mouse ECHA(37-768) K351R in E.coli cells (no His-tag)DepositorInsertTrifunctional enzyme subunit alpha, mitochondrial (Hadha Mouse)
TagsFLAG-taggedExpressionBacterialMutationdeleted amino acid 1-36, mutated lysine 351 to ar…PromoterT7AvailabilityAcademic Institutions and Nonprofits only -
pB-EF1a-FastFUCCI-IRES-3xnls-mTagBFP2 (JDW 1511)
Plasmid#242599PurposeA PiggyBac expression vector containing the human EF1a promoter driving FastFUCCI to label cell cycle state followed by an IRES-3xnls-mTagBFP2.DepositorInsertmKO2-hCDT1(30-120) T2A mAG-hGEM(1-110) (EEF1A1 Human)
ExpressionMammalianPromoterhuman EF1aAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Flag-ER-Hoxb8-IRES-GFP
Plasmid#222292PurposeLess commonly used plasmid for generating ER-Hoxb8 conditionally immortalized myeloid cell lines.DepositorUseRetroviralTagsFlagExpressionMammalianMutationThe estrogen receptor hormone binding domain cont…Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
G13-CASE
Plasmid#168127PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein G13. Composed of the subunits G alpha 13 (GNA13) tagged with NanoLuciferase, G beta 3 (GNB3) and Venus-tagged G gamma 9 (GNG9).DepositorUseLuciferaseTagscpVenus on GNG9ExpressionMammalianMutationNLuc is inserted at F125/D126 within GNA13Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Gi3-CASE
Plasmid#168122PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein Gi3. Composed of the subunits G alpha i3 (GNAI3) tagged with NanoLuciferase, G beta 1 (GNB1) and Venus-tagged G gamma 2 (GNG2).DepositorUseLuciferaseTagscpVenus on GNG2ExpressionMammalianMutationNLuc is inserted at A114/E115 within GNAI1Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
G15-CASE
Plasmid#168126PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein G15. Composed of the subunits G alpha 15 (GNA15) tagged with NanoLuciferase, G beta 3 (GNB3) and Venus-tagged G gamma 9 (GNG9).DepositorUseLuciferaseTagscpVenus on GNG9ExpressionMammalianMutationNLuc is inserted at E244/N245 within GNA15Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FAS-Fc(DAPA)-AviTag-6xHis
Plasmid#156541PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertFAS (FAS Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceAug. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FASLG-Fc(DAPA)-AviTag-6xHis
Plasmid#156578PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertFASLG (FASLG Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
G12-CASE
Plasmid#190714PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein G12. Composed of the subunits G alpha 12 (GNA12) tagged with NanoLuciferase, G beta 3 (GNB3) and Venus-tagged G gamma 9 (GNG9).DepositorUseLuciferaseTagsNluc is inserted at A133/F134 within GNA12 and cp…ExpressionMammalianAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAB2076 pAAV REPAIR.t1
Plasmid#176323PurposepAAV EFS-HIVNES-dCas13bt1- (GGS)2-huADAR2(E488Q)-3xHA BGHpolyA::U6-BpiI-Cas13bt1 DR (full REPAIR.t1 + crRNA expression for AAV production)DepositorInsertshuman codon optimized Cas13bt1 (catalytically inactivated)
huADAR2dd(E488Q) (ADARB1 Human)
Cas13bt1 crRNA + BpiI cloning site
UseAAV and CRISPRTags3xHA and HIV NESExpressionMammalianMutationE488Q, only the deaminase domain (aa 276-702 are …PromoterEFS (short EF1alpha) and hU6Available SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
Gi1-CASE
Plasmid#168120PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein Gi1. Composed of the subunits G alpha i1 (GNAI1) tagged with NanoLuciferase, G beta 1 (GNB1) and Venus-tagged G gamma 2 (GNG2).DepositorUseLuciferaseTagscpVenus on GNG2ExpressionMammalianMutationNLuc is inserted at A121/E122 within GNAI1Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only