We narrowed to 13,951 results for: CRISPR-Cas9
-
Plasmid#126698Purposeto express Cas9 from S. pyogenes with 2A-EGFP and sgRNA targeting human SCGB3A2 locus at the end of the endogenous coding sequenceDepositorInsertsgRNA targeting human SCGB3A2 locus
ExpressionMammalianPromoterHuman U6Available SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1-Hsp2Cas9-KY-P2A-puro
Plasmid#192133PurposeExpresses highly specific Hsp1-Hsp2Cas9, cloning backbone for sgRNA and puromycin resistance geneDepositorInsertHsp1-Hsp2Cas9-KY
UseAAVExpressionMammalianMutationHsp1-Hsp2Cas9 (K390A, Y446A)Available SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAG-DDdCas9VP192-T2A-EGFP-ires-puro
Plasmid#69534PurposeDHFR destabilised domain (DD) fused to dCas9VP192 (S.pyogenes) on CAG expression vector. DDdCas9VP192 protein is stabilised by Trimethoprim.DepositorInsertDD-dCas9VP192-T2A-EGFP
TagsC-term T2A-EGFP and DHFR Destabilised DomainExpressionMammalianPromoterCAGAvailable SinceNov. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRS315e_pGal-dCas9-SH3-pGal-PmCDA1-SHL
Plasmid#79614PurposeExpresses dCas9-SH3 and PmCDA1-SHL in yeast cellsDepositorInsertsSpCas9
PmCDA1
TagsSH3 domain and SHLExpressionYeastMutationD10A and H840A for nuclease deficient Cas9PromoterpGal1 and pGal10Available SinceJuly 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBK2043-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9
Plasmid#223163Purpose2nd gen. AAV backbone for dSaCas9 (endonuclease dead Cas9 from Staphylococcus aureus) and Sa-gRNA ScaffoldDepositorTypeEmpty backboneUseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)Available SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1-Hsp2Cas9-Y-P2A-puro
Plasmid#192132PurposeExpresses highly specific Hsp1-Hsp2Cas9, cloning backbone for sgRNA and puromycin resistance geneDepositorInsertHsp1-Hsp2Cas9-Y
UseAAVExpressionMammalianMutationHsp1-Hsp2Cas9 (Y446A)Available SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVH333-1-Tier1-PhCMV-dCas9-3xNLS-VP64
Plasmid#169597PurposeTier-1 vector encoding PhCMV-driven dCas9-3xNLS-VP64 expression (PhCMV-dCas9-3xNLS-VP64-pA).DepositorInsertdead S.pyogenes Cas9 - VP64 fusion
ExpressionMammalianPromoterPhCMVAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG>nls-Cas9-nls-2A-Citrine-EcoRI/NotI
Plasmid#169097PurposeCas9 and Citrine expression in transfected cellsDepositorInsertCas9-2A-Citrine
ExpressionMammalianAvailable SinceAug. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPD292 PPH/HBB_IVS2/-T2A-dCas9-NFZ-P2A-BFP
Plasmid#249156PurposeOverexpression of PPH-T2A-dCas9-NFZ-P2A-BFP with HBB IVS2 intron in PPH coding sequence and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertPPH/HBB_IVS2/-T2A-dCas9-NFZ-P2A-mTagBFP2 (HBB Human, S. pyogenes Cas9, synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHBB IVS2 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
EFS-FLAG-SpCas9-6xNLS(c-Myc)-P2A-Puro (pRG214)
Plasmid#221385PurposeLentiviral expression of SpCas9-6xNLS(c-Myc) with puromycin resistance geneDepositorInsertSpCas9
UseCRISPR and LentiviralTagsFLAGExpressionMammalianAvailable SinceJune 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRha-ABE8e-SpCas9-NG
Plasmid#201190PurposeExpresses the base editor ABE8e-SpCas9-NG in bacterial cellsDepositorInsertABE8e-SpCas9-NG
Tags8xHIS and BP-NLSExpressionBacterialPromoterpRhaBADAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.GFP
Plasmid#57827PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-eGFP
UseCRISPR and LentiviralTagsFLAGAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eCas9-T2A-EGFP-U6-gRNA targeting Nrl-no ITR and f1 ori
Plasmid#234737PurposeAll-in-one CRISPR/Cas9 vector encodes high-fidelity eSpCas9 and a gRNA targeting Nrl, efficiently reprogramming rod precursors into cone-like cells in the mouse retina.DepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_NOT_iC
Plasmid#231418PurposeThis NOT-gate plasmid expresses dCas9 from a constitutive promoter, and GFP from a promoter repressible by sgRNA-C1. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ290.)DepositorInsertsdCas9
GFP
UseSynthetic BiologyAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_NOT_iA
Plasmid#231417PurposeThis NOT-gate plasmid expresses dCas9 from a constitutive promoter, and GFP from a promoter repressible by sgRNA-A1. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ285.)DepositorInsertsdCas9
GFP
UseSynthetic BiologyAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8.20m-SpCas9-NRTH-P2A-EGFP (RMD63)
Plasmid#197500PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE(8.20) A-to-G base editor with nSpCas9-NRTH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8.20m-nSpCas9-NRTH-BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.20 mutations in TadA and nSpCas9-NRTH(D10A/I…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgAMPKa2-Cas9-GFP
Plasmid#208050PurposeLentiviral vector expressing Cas9 and an sgRNA targeting AMPKa2DepositorAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-Cas9-VQR-Blast
Plasmid#87155Purposelentiviral expression of SpCas9-VQR (NGA PAM restricted)DepositorInsertSpCas9-VQR(D1135V,R1335Q,T1337R)
UseLentiviralMutationD1135V,R1335Q,T1337RAvailable SinceFeb. 27, 2017AvailabilityAcademic Institutions and Nonprofits only