We narrowed to 3,402 results for: aaas
-
Plasmid#76007Purpose3rd generation lentiviral gRNA plasmid targeting human MAP3K10DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
NME1-NME2 gRNA (BRDN0001162403)
Plasmid#75887Purpose3rd generation lentiviral gRNA plasmid targeting human NME1-NME2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
IDNK gRNA (BRDN0001147773)
Plasmid#75866Purpose3rd generation lentiviral gRNA plasmid targeting human IDNKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STKLD1 gRNA (BRDN0001148566)
Plasmid#75812Purpose3rd generation lentiviral gRNA plasmid targeting human STKLD1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ADK gRNA (BRDN0001146622)
Plasmid#75744Purpose3rd generation lentiviral gRNA plasmid targeting human ADKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHA1 gRNA (BRDN0001147142)
Plasmid#75590Purpose3rd generation lentiviral gRNA plasmid targeting human EPHA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pQCXIX_sh_hBcl10_#2
Plasmid#75254Purposeretroviral shRNA vector against human BCL10, expresses GFP for transduction controlDepositorAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
RalA (G23V)(mature peptide)-pcw107-V5
Plasmid#64643Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
RalA (G23V)(mature peptide)-pcw107
Plasmid#64642Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
JAK2 (V617F)-pcw107-V5
Plasmid#64610Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAS
Plasmid#60847PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeastDepositorInsertsS. pyogenese Cas9
RNA pol III promoter (tRNA-Tyr)
hepatitis delta virus ribozyme, genomic
sgRNA
UseCRISPR and Synthetic BiologyTagsNLS/His8 and TTT 3' extension prior to sgRNAExpressionBacterial and YeastMutationL4 is UUCG tetraloop and guide targets LYP1 (CATA…Available SinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
EIF2AK3 gRNA (BRDN0001145848)
Plasmid#77166Purpose3rd generation lentiviral gRNA plasmid targeting human EIF2AK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PB09-TRE-beta-globin-miR-124-EF1a-GFP
Plasmid#117318PurposeOverexpression of miR-124 in eurkaryotic cells, encoded in a human beta-globin intronDepositorInserthsa-miR-124-1 (MIR124-1 Human)
UseTransposon-mediated integrationTagsGFPExpressionMammalianPromoterTet-inducible promoterAvailable SinceJan. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
MERTK gRNA (BRDN0001145505)
Plasmid#76444Purpose3rd generation lentiviral gRNA plasmid targeting human MERTKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EIF2AK4 gRNA (BRDN0001146469)
Plasmid#75876Purpose3rd generation lentiviral gRNA plasmid targeting human EIF2AK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TGFbetaR1 (T204D)-pcw107-V5
Plasmid#64629Purposewhen used to produce lentivirus, express physiological levels of insertDepositorInsertTGFBR1 (transcript variant 1) (TGFBR1 Human)
UseLentiviralTagsV5MutationT204DPromoterPGKAvailable SinceJune 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgBrca2#1/Cre
Plasmid#173627PurposeExpresses a Brca2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Brca2 (Brca2 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgKeap1#1/Cre
Plasmid#173639PurposeExpresses a Keap1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Keap1 (Keap1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only