We narrowed to 10,252 results for: tre promoter
-
Plasmid#202512PurposeExpressing luciferase driven by human ACSL4 promoter (bases -1 to -254 with respect to exon1 start site)DepositorAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pGL3-ACSL4-(-706)
Plasmid#202513PurposeExpressing luciferase driven by human ACSL4 promoter (bases -1 to -706 with respect to exon1 start site)DepositorAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
KLC1N343S-Myc
Plasmid#166963PurposeExpresses Myc-tagged KLC1 N343S protein in pcDNA3.1DepositorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1sgRNA2
Plasmid#160946PurposeGuide RNA 2 to generate Nr4a1 knockout by CRISPRDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Puro-FH-AGO2-S824E-S828E
Plasmid#91999PurposeExpresses FLAG-HA-AGO2 (S824E-S828E)DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Puro-FH-AGO2-S824E-S831E
Plasmid#92000PurposeExpresses FLAG-HA-AGO2 (S824E-S831E)DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Puro-FH-AGO2-S828E-S831E
Plasmid#92001PurposeExpresses FLAG-HA-AGO2 (S828E-S831E)DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Puro-FH-AGO2-S824E-S828E-S831E
Plasmid#92002PurposeExpresses FLAG-HA-AGO2 (S824E-S828E-S831E)DepositorInsertAGO2 (AGO2 Human)
UseRetroviralTagsFLAG-HAExpressionMammalianMutationS824E, S828E, S831EAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Puro-FH-AGO2-S824A-T830A
Plasmid#92003PurposeExpresses FLAG-HA-AGO2 (S824A-T830A)DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
-161+80pCalb2/mutE2F(-69)-like
Plasmid#66743Purposeluciferase reporter for Calb2 promoter (-161to +80, mutant)DepositorInsertCalb2 promoter (-161bp+80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationGCG (-69,-68,-67) to ATTPromoterCalb2Available SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-HNF1A-WT-Flag-UTR
Plasmid#183237PurposeExpression of FLAG tagged HNF1ADepositorAvailable SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 KBTBD4 WT
Plasmid#184627PurposeMammalian expression vector with N-terminal 3xFlag for KBTBD4 WT expression in mammalian cellsDepositorInsertN-terminal 3xFlag tagged KBTBD4 WT (KBTBD4 Human)
ExpressionMammalianMutationno mutationPromoterCMVAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-GCN5
Plasmid#65386PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 Full length Importin beta
Plasmid#106941PurposeTransient expression of GFP-tagged Importin beta in mammalian cells (CMV promoter)DepositorInserthuman Importin beta-1 (KPNB1) (KPNB1 Human)
TagsGFPExpressionMammalianPromoterCMV promoterAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-BAZ1B
Plasmid#65372PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-BAZ1A
Plasmid#65371PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorInsertBAZ1A (BAZ1A Human)
TagsEmGFP and V5ExpressionMammalianMutation796I compared to all reference sequencesPromoterCMVAvailable SinceJune 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV.tetO.Ascl1.U6.shRest1.U6.shRest2
Plasmid#234846Purpose3rd generation lentiviral vector, expresses Ascl1 under control of TetON promoter and two shREST sequences under control of U6 promotersDepositorAvailable SinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
plenti-CAG-IKZF1-V1-Q146H-FLAG-IRES-GFP
Plasmid#69048Purposelentiviral expression of IKZF1 variant 1 with Q146H mutation and FLAG tagDepositorInsertIKZF1 (IKZF1 Human)
UseLentiviralTagsFLAG and IRES-GFPExpressionMammalianMutationsplice variant 1, Q146HPromoterCAGAvailable SinceOct. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-PCAF (delta5-53a.a.)
Plasmid#65388PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorInsertPCAF (KAT2B Human)
TagsEmGFP and V5ExpressionMammalianMutationlost 13-159bp of the ORFPromoterCMVAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only