We narrowed to 8,874 results for: BLI;
-
Plasmid#52517Purposeexpresses C. elegans DRE-1 in mammalian cells with RGS-6xHis tag at N-terminusDepositorInsertDre-1 (dre-1 Nematode)
UseTagsRGS-6xHisExpressionMammalianMutationPromoterCMVAvailable sinceJuly 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-7 a-syn A53T D115A mNeonGreen-3K-B11
Plasmid#232017PurposeBacterial expression of alpha synuclein A53T mutant, tagged with the final beta strand of mNeonGreen-3KDepositorInsertSNCA (SNCA Human)
UseTagsmNeonGreen-3K beta11ExpressionBacterialMutationAla53Thr Asp115AlaPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV mTagBFP2-2A-CHMP2B
Plasmid#232000PurposeBicistronic expression of CHMP2B along with an mTagBFP2 transfection marker, connected via 2A sequences.DepositorInsertCHMP2B (CHMP2B Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV mTagBFP2-2A-CHMP2B-Q165X
Plasmid#232001PurposeBicistronic expression of CHMP2B Q165X mutant along with an mTagBFP2 transfection marker, connected via 2A sequences.DepositorInsertCHMP2B (CHMP2B Human)
UseTagsExpressionMammalianMutationQ165XPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D F5D-3XHA
Plasmid#232003PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with a 3xHA tag.DepositorInsertCHMP2B (CHMP2B Human)
UseTags3xHAExpressionMammalianMutationL4D F5DPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1a FLAG-CHMP2B-d55-96
Plasmid#232013PurposeExpression of FLAG-tagged CHMP2B with the second alpha helix deleted.DepositorInsertCHMP2B (CHMP2B Human)
UseLentiviralTagsFLAGExpressionMammalianMutationΔ55-96PromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorInsertCHMP2B-targeted sgRNA (CHMP2B Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SNCA-A53T-mClover3
Plasmid#215378PurposeExpression of the A53T mutant of alpha-synuclein with a C-terminal mClover3 tag.DepositorInsertSNCA (SNCA Human)
UseTagsmClover3 tagExpressionMammalianMutationAla53ThrPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SNCA-A53T-mRuby3
Plasmid#215379PurposeExpression of the A53T mutant of alpha-synuclein with a C-terminal mRuby3 tag.DepositorInsertSNCA (SNCA Human)
UseTagsmRuby3 tagExpressionMammalianMutationAla53ThrPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTetOFF SNCA-A53T
Plasmid#215372PurposeAll-in-one lentiviral construct for the dox repressible expression of the A53T mutant of alpha-synuclein.DepositorInsertSNCA (SNCA Human)
UseTagsExpressionMammalianMutationAla53ThrPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCR197
Plasmid#240643PurposeExpression of the tri-cistronic construct NES-AmNeonGreen-P2A-mTurquoise2-NLS-T2A-mScarlet-I-PTS1 in Exaiptasia diaphana; In vitro transcription of the same construct via SP6 polymeraseDepositorInsertsAIPGENE865 promoter
SP6 promoter
AmNeonGreen
mTurquoise2
mScarlet-I
UseGene expression and genomic integration in fishTagsNES (from Exaiptasia diaphana MEK2), NLS (from SV…ExpressionMutationCodon-optimized for Exaiptasia diaphana, amino ac…PromoterAvailable sinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP(N55D)-CNOT7-V5H6.MCh.Puro
Plasmid#209949PurposeIn mammalian cells expresses non-binding TP mutant fused to a CNOT7 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) with a N55D mutation that i…ExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-(inactive)CNOT7-V5H6.MCh.Puro
Plasmid#209936PurposeIn mammalian cells expresses TP fused to an inactive CNOT7 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsEnzymatically inactive CCR4-NOT transcription complex subunit 7 (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusCNOT6interaction)-V5H6.MCh.Puro
Plasmid#209940PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with CNOT6 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with CNOT6) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusCNOT6NOT1interaction)-V5H6.MCh.Puro
Plasmid#209941PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with CNOT6 or NOT1 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with NOT1 and CNOT6) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusNOT1interaction)-V5H6.MCh.Puro
Plasmid#209942PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with NOT1 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with NOT1) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-flag-IARS2-Δ1-48
Plasmid#232341PurposeExpresses human IARS2 with mito-location signal replaced by flag tag in mammalian cells, also carrying synonymous mutations described in Addgene #232340DepositorInsertIARS2 (IARS2 Human)
UseTagsExpressionMammalianMutationResidues 1-48 (indicated as Mito-signal in UniPro…PromoterCMVAvailable sinceJune 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV PHP.eB-CAG-Venus
Plasmid#233695PurposeAAV expression of Venus from CAG promoterDepositorInsertVenus
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSMPPv2-Tau-RING
Plasmid#233688PurposeExpression of Tau-RING protein in mammalian cellsDepositorInsertTau protein fused to TRIM21 RING domain
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Flag-Jarid2-polyA
Plasmid#223811PurposeIVT of Flag-Jarid2 mRNA with polyA tail, by the T7 promoter.DepositorInsertJarid2 (Jarid2 Mouse)
UseIn vitro transcriptionTagsFlagExpressionMammalianMutationPromoterCMV, T7Available sinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-Twin-strep-TEV-DGKδ2-DSAMD
Plasmid#223721PurposeExpress human diacylglycerol kinase delta 2- SAM domain deletion mutant (N-terminal TEV protease cleavable Twin-Strep-fusion protein) in mammalian cellDepositorInsertDGKD (DGKD Human)
UseTagsTEV cleavable site and Twin-Strep-tagExpressionMammalianMutationdeleted sterile alpha motif domain (deleted amino…PromoterCAG and chicken β-actin promoterAvailable sinceJan. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-ZFYVE27 S14D S25D S32D T261D-WPRE-UbC-Emerald
Plasmid#214468PurposeLentiviral vector plasmid expressing human ZFYVE27 mutations S14D S25D S32D T261D under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsExpressionMammalianMutationS14D S25D S32D T261DPromoterAvailable sinceJuly 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-ZFYVE27 S14D S25D S32D T261D-WPRE-UbC-mCherry
Plasmid#214471PurposeLentiviral vector plasmid expressing human ZFYVE27 mutations S14D S25D S32D T261D under the spleen focus-forming virus (SFFV) promoter and mCherry under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsExpressionMammalianMutationS14D S25D S32D T261DPromoterAvailable sinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR-Creb5(HA)
Plasmid#195022PurposeGateway vector containing HA-tagged Creb5DepositorInsertHA-tagged Creb5 (full length, 508aa) (CREB5 Bovine)
UseGateway cloningTags3xHAExpressionMutationPromoterAvailable sinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
GL4.10 E2E1- Prg4 promoter-luciferase
Plasmid#195035PurposePrg4 enhancer/promoterfirefly luciferase constructs were constructed by cloning various Prg4 regulatory fragments into pGL4.10[luc2] vectorDepositorInsertPrg4 promoter plus Enhancer 1 and Enhancer 2 (PRG4 Bovine)
UseLuciferaseTagsExpressionMutationPromoterAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.10 E3E2E1-Prg4 promoter-luciferase
Plasmid#195036PurposePrg4 enhancer/promoterfirefly luciferase constructs were constructed by cloning various Prg4 regulatory fragments into pGL4.10[luc2] vectorDepositorInsertPrg4 promoter plus Enhancer 1, Enhancer 2, and Enhancer 3 (PRG4 Bovine)
UseLuciferaseTagsExpressionMutationPromoterAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.10 E4E3E2E1-Prg4 promoter-luciferase
Plasmid#195037PurposePrg4 enhancer/promoterfirefly luciferase constructs were constructed by cloning various Prg4 regulatory fragments into pGL4.10[luc2] vectorDepositorInsertpGL4.10 E4E3E2E1-Prg4 promoter-luciferase (PRG4 Bovine)
UseLuciferaseTagsExpressionMutationPromoterAvailable sinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
Venus-Bik-del72-136-pEGFP-C3
Plasmid#191411PurposeTransfection of this plasmid will express "VBik-d72-136" (Venus fused to the N-terminus of the BH3-only protein, Bik that has amino acids 72-136 deleted).DepositorInsertBcl-2-interacting killer (BIK Human)
UseTagsVenusExpressionMammalianMutationwith deletion of amino acids 72-136 (del72-136) i…PromoterCMVAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_HLA-cmyc-GRM3 C127A TMD Y616M
Plasmid#140454PurposeMammalian expression plasmid for c-myc-tagged mGluR3 C127A and Y616M mutantDepositorInsertGRM3 (GRM3 Human)
UseTagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationCysteine 127 to alanine, tyrosine 616 to methioni…PromoterAvailable sinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_HLA-cmyc-GRM3 C127A TMD L624N
Plasmid#140455PurposeMammalian expression plasmid for c-myc-tagged mGluR3 C127A and L624N mutantDepositorInsertGRM3 (GRM3 Human)
UseTagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationCysteine 127 to alanine, leucine 624 to asparaginePromoterAvailable sinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_HLA-cmyc-GRM3 C127A TMD A634N
Plasmid#140456PurposeMammalian expression plasmid for c-myc-tagged mGluR3 C127A and A634N mutantDepositorInsertGRM3 (GRM3 Human)
UseTagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationCysteine 127 to alanine, alanine 634 to asparaginePromoterAvailable sinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4_HLA-flag-GRM3 C127A-VN
Plasmid#140449PurposeMammalian expression plasmid for FLAG-tagged mGluR3 fused to the N-terminal half of split fluorescent Venus (VN)DepositorInsertGRM3 (GRM3 Human)
UseTagsFLAG tag, Signal/leader sequence from HLA class I…ExpressionMammalianMutationCysteine 127 to alaninePromoterAvailable sinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4_HLA-myc-GRM3 C127A-VC
Plasmid#140450PurposeMammalian expression plasmid for c-myc-tagged mGluR3 fused to the C-terminal half of split fluorescent Venus (VC)DepositorInsertGRM3 (GRM3 Human)
UseTagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationCysteine 127 to alaninePromoterAvailable sinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_HLA-cmyc-GRM3 C127A TMD I578A
Plasmid#140452PurposeMammalian expression plasmid for c-myc-tagged mGluR3 C127A and I578A mutantDepositorInsertGRM3 (GRM3 Human)
UseTagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationCysteine 127 to alanine, isoluecine 578 to alaninePromoterAvailable sinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_HLA-cmyc-GRM3 C127A TMD F588V
Plasmid#140453PurposeMammalian expression plasmid for c-myc-tagged mGluR3 C127A and F588V mutantDepositorInsertGRM3 (GRM3 Human)
UseTagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationCysteine 127 to alanine, phenylalanine 588 to val…PromoterAvailable sinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
attB53-Pac-tetO-mCherry-attB53
Plasmid#183612PurposeRMCE vector to shuttle puromycin resistance and tetO-mCherry cassettes into attP50-flanked landing pad. Designed for use with pmROSA26-attP50-Neo-mKate2-3xNLS-attP50 vector (Addgene 183609).DepositorInserttetO-mCherry
UseRmceTagsExpressionMutationPromotertetOAvailable sinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB6-Id1-IRES-loxP-NeoR-loxP-DTA-TK
Plasmid#158616PurposeB6J Id1-LSL-DTA allele targeting vector, low copy numberDepositorInsertId1 (Id1 Mouse)
UseCre/Lox and Mouse TargetingTagsExpressionMammalianMutationInsertion of IRES-loxP-NeoR-loxP-DTA after the st…PromoterAvailable sinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-MIOX only
Plasmid#166683PurposeYeast integrative plasmid for expressing mouse myo-inositol oxygenase fused to GFP (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertGFP-MIOX
UseSynthetic BiologyTagsExpressionYeastMutationPromoterGAL10Available sinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTEF1-UDH
Plasmid#166679PurposeYeast integrative plasmid for expressing P. syringae uronate dehydrogenase, with TEF1 promoter. Contains leucine auxotrophic marker (K. lactis LEU2).DepositorInsertUDH
UseSynthetic BiologyTagsExpressionYeastMutationPromoterTEF1Available sinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
wtVP1 only
Plasmid#166673PurposeYeast integrative plasmid for expressing wild-type Murine polyomavirus VP1, with GAL1 promoter. Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertWild-type Murine polyomavirus VP1
UseSynthetic BiologyTagsExpressionYeastMutationPromoterGAL1Available sinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK2 3'UTR KGA
Plasmid#110402PurposeLuminescence-based glutaminase KGA isoform 3'UTR-mediated RNA stability reporterDepositorInsertGLS glutaminase (GLS Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterSV40Available sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330.puro sgRNA KGA Stop1
Plasmid#110405PurposeCRISPR/Cas9 vector with sgRNA for glutaminase KGA isoform C-Terminal Knock-in and puromycin resistanceDepositorInsertGLS glutaminase (GLS Human)
UseCRISPRTagsExpressionMammalianMutationPromoterCBhAvailable sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC19 KGA HA5'-mKO2-P2A-Zeo-3'
Plasmid#110408PurposeHomology donor for glutaminase KGA isoform knock-in, mKO2-P2A-ZeoDepositorInsertGLS glutaminase (GLS Human)
UseCRISPRTagsExpressionMutationPromoternoneAvailable sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
p1A CbbL-
Plasmid#162693Purposep1A negative control expressing inactive CbbLS (carbamylated K194M mutation) and PrkDepositorInsertH. neapolitanus CbbLS and S. elongatus Prk
UseTagsN terminal 6x His tag on PRKExpressionBacterialMutationCbbL K194M (inactive rubisco)PromoterPLtet0-1 promoterAvailable sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
SNX17-PX (1-111)
Plasmid#119098PurposeBacterial expression of human phox homology (PX) domain, SNX17-PX (1-111)DepositorInsertSNX17-PX (1-111) (SNX17 Human)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceApril 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
SNX16-PX (104-216)
Plasmid#119097PurposeBacterial expression of human phox homology (PX) domain, SNX16-PX (104-216)DepositorInsertSNX16-PX (104-216) (SNX16 Human)
UseTagsExpressionMutationPromoterN/AAvailable sinceApril 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
SNX4-PX (48-186)
Plasmid#119085PurposeBacterial expression of human phox homology (PX) domain, SNX4-PX (48-186)DepositorInsertSNX4-PX (48-186) (SNX4 Human)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceApril 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
SNX32-PX (17-166)
Plasmid#119111PurposeBacterial expression of human phox homology (PX) domain, SNX32-PX (17-166)DepositorInsertSNX32-PX (17-166) (SNX32 Human)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
SNX7-PX (89-218)
Plasmid#119088PurposeBacterial expression of human phox homology (PX) domain, SNX7-PX (89-218)DepositorInsertSNX7-PX (89-218) (SNX7 Human)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET14b-dabAB2 D353A
Plasmid#133016PurposepET14b carrying the dabA2 gene (Uniprot: D0KWS7) with a D353A mutation fused to a c-terminal strep tag and the dabB2 gene (Uniprot: D0KWS8) with a c-terminal sfGFP V206K fusion and 6xHis tagDepositorInsertsdabB2
dabA2
UseTags6xHis, StrepII tag, and sfGFPExpressionBacterialMutationD353APromotert7Available sinceNov. 11, 2019AvailabilityAcademic Institutions and Nonprofits only