We narrowed to 13,167 results for: Green Fluorescent Protein
-
Plasmid#35350DepositorPublicationInsertGFP
UseSynthetic BiologyExpressionBacterialPromoterProEAvailable sinceFeb. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBbB3c-GFP
Plasmid#35347DepositorPublicationInsertGFP
UseSynthetic BiologyExpressionBacterialPromoterProSAvailable sinceFeb. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLenti X2 Zeo/pTER shGFP #2 (790-1)
Plasmid#22529DepositorInsertsh Enhanced Green Fluorescent Protein #2
UseLentiviral and RNAiAvailable sinceDec. 18, 2009AvailabilityAcademic Institutions and Nonprofits only -
pmRNA-EGFP-A120
Plasmid#225903PurposeIn vitro transcription of cap-dependently translated mRNA encoding EGFP.DepositorInsertsA-inserted T7 class III Φ6.5 promoter
EGFP
2x β-globin UTR
poly(A) tail
UseSynthetic Biology; Mrna preparationExpressionMammalianAvailable sinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available sinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP34∆RBS
Plasmid#247213PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from a T7 promoter but lacks a ribosomal binding site. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available sinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCVL.SSA TLR (CCR5 TALEN Sce Spacer)
Plasmid#46941PurposeCodes for the SSA-TLR with the target site for the CCR5 TALEN with the spacer region corresponding to I-Sce I in a lentiviral backboneDepositorPublicationInserts5' iRFP arm
eGFP with TALEN TS
+3 mCherry
3' iRFP arm
UseLentiviralExpressionBacterial and MammalianMutationembedded TALEN TS from 163-218, truncated 25 amin…PromoterSFFVAvailable sinceNov. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C3001
Plasmid#91094PurposeModule C, Promoter: 35S, Gene: GFP (+ BaeI site for GT donor cloning), Terminator: pea rbcsE9DepositorInsertGFP (+ BaeI site for GT donor cloning)
UseUnspecifiedPromoter35SAvailable sinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3.1-GGamma11-GFP2
Plasmid#166780PurposeEncodes a G gamma subunit containing GFP2 as an "non-optimal" component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGGamma11-GFP2 (GNG11 Synthetic, Human)
ExpressionMammalianMutationContains an N-terminal GFP2 and GSAG linkerPromoterCMVAvailable sinceApril 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPMS-2397
Plasmid#231044PurposeUsed for staining GFPDepositorInsertanti GFP DARPin fused to chicken Fc
UseAffinity Reagent/ AntibodyTags8xHisExpressionMammalianAvailable sinceJan. 17, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pNY-345
Plasmid#231045PurposeUsed for staining GFPDepositorInsertanti GFP DARPin fused to rabbit Fc
UseAffinity Reagent/ AntibodyExpressionMammalianAvailable sinceJan. 17, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pNY-347
Plasmid#231047PurposeUsed for GFP stainingDepositorInsertanti GFP DARPin fused to mouse Fc
UseAffinity Reagent/ AntibodyExpressionMammalianAvailable sinceJan. 17, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJBL7368
Plasmid#217375PurposesfGFP reporter for Bce crcB fluoride riboswitchDepositorPublicationInsertBce crcB riboswitch sfGFP reporter
Available sinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pIND4-GFP-MmXYRS
Plasmid#222745PurposeExpresses sfGFP and aaRS-tRNA pair for incorporating haloalkane crosslinkerDepositorInsertssfGFP
MmXYRS
Mm Pyl tRNA
Tags6xHisMutationContains the following substitutions: V346A, W348…PromoterrrnBAvailable sinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-ExSYTE
Plasmid#216263PurposeCre-dependent expressoin of ExSYTE (P2A) EGFP with 3'UTR of Rat Arc DTE under synapsin promoterDepositorInsertExSYTE P2A EGFP - Rat DTE
UseAAVAvailable sinceMay 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV(gRNA)-CMV-eGFP-U6(sgCTG)
Plasmid#216732PurposeContains a eGFP gene along with a U6 promoter driving the sgCTG (target sequence: (CUG)6). Used with the HD iPSC-derived astrocytesDepositorPublicationInsertsgCTG lentiviral guide RNA with eGFP tag
UseCRISPR and LentiviralExpressionMammalianPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCJH009_proD_Cas12c-sgRNA-GFP_CAM
Plasmid#183070PurposePlasmid expressing Cas12c sgRNA targeting GFP (1) for in vivo interference assay in bacteria.DepositorInsertCas12c single guide RNA targeting GFP
UseCRISPRExpressionBacterialAvailable sinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
AiP1181-Ai224 (TICL-nls-EGFP-ICF-nls-dTomato)
Plasmid#181760Purposetargeting vectorDepositorInsertnls-tagged EGFP and nls-tagged dTomato
ExpressionMammalianAvailable sinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT-9222
Plasmid#124222PurposeCloning plasmid for EGxFP assay with self-targeting gRNA-sDepositorInsertself-targeting gRNA between EGFP halves
UseCRISPRExpressionMammalianPromoterCAGAvailable sinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDOC-K-glmS-GFPrev
Plasmid#158060PurposeDonor plasmid for insertion of eGFP and the constitutive acpP promoter into the S. Typhimurium chromosome. GFP is in the reverse orientation relative to the kanamycin resistance selectable markerDepositorInsertGreen Fluorescent Protein optimised for excitation with UV light
UseSynthetic BiologyExpressionBacterialPromoteracpPAvailable sinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only