We narrowed to 9,660 results for: CAG
-
Plasmid#114402PurposeFor PYL-HDAC5 N terminal domain expressionDepositorInsertPYL-HDAC5 N terminal domain
Tags3xFlag-NLS (internal)ExpressionMammalianMutationD593E compared to NCBI ref NP_005465.2PromoterCMVAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAK_DR30_CasRx_GFP
Plasmid#134843PurposeAll in one overexpression of CasRx and guideRNADepositorInsertRfxCas13d
UseCRISPRTagsT2A EGFPExpressionMammalianPromoterCAGAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAK_DR30_CasRx_mCherry
Plasmid#134844PurposeAll in one overexpression of CasRx and guideRNADepositorInsertRfxCas13d
UseCRISPRTagsT2A mCherryExpressionMammalianPromoterCAGAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAK_DR30_CasRx_Puro
Plasmid#134845PurposeAll in one overexpression of CasRx and guideRNADepositorInsertRfxCas13d
UseCRISPRTagsT2A PuromycinExpressionMammalianPromoterCAGAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRT043-CLYBL-DDdcas9-VPH
Plasmid#158091PurposeInducible expression of dCas9-VPH from the CLYBL locus for CRISPR activationDepositorInsertCLYBL-CAG-DDdCas9VPH-T2A-GFP
UseTALENExpressionMammalianPromoterCAGAvailable SinceJune 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMTL5
Plasmid#127967PurposeDHFR-degron controlled expression of KRAB-dCas9-BFP-KRAB from the AAVS1 locusDepositorInsertAAVS1-CAG-DHFR-KRAB-dCas9-BFP-KRAB
UseTALENExpressionMammalianPromoterCAGAvailable SinceNov. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRT029
Plasmid#127969Purposedouble-DHFR-degron controlled expression of dCas9-BFP-KRAB from the CLYBL locusDepositorInsertCLYBL-CAG-DHFR-dCas9-BFP-KRAB-DHFR
UseTALENExpressionMammalianPromoterCAGAvailable SinceAug. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMTL3
Plasmid#127966Purposeconstitutive expression of KRAB-dCas9-BFP-KRAB from the AAVS1 locusDepositorInsertAAVS1-CAG-KRAB-dCas9-BFP-KRAB
UseTALENExpressionMammalianPromoterCAGAvailable SinceNov. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330_VCL sgRNA / hSpCas9
Plasmid#172837PurposeMammalian expression of a sgRNA targeting the intron 21 (last intron) of VCL (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 21 of VCL under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_TOMM20 sgRNA / hSpCas9
Plasmid#172836PurposeMammalian expression of a sgRNA targeting the intron 4 (last intron) of TOMM20 (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 4 of TOMM20 under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i4 sgRNA / hSpCas9
Plasmid#172828PurposeMammalian expression of a sgRNA targeting the intron 1 position 4 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenLox_U6 Nlgn2
Plasmid#59358PurposeLentiviral expression vector: Neuroligin 2 shRNA under control of mouse U6 promoter, EGFP-expression driven by CAG promoter to monitor expression.DepositorUseLentiviralExpressionMammalianPromoterCAG and mouse U6Available SinceDec. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
R26TV LSL-TRL
Plasmid#68476PurposeRosa26 targeting vector expressing Cre-dependent tTR-KRAB-rtTA3-Luc cassetteDepositorInserttTR-KRAB-2A-rtTA3-2A-Luciferase
UseCre/Lox, Luciferase, and Mouse TargetingExpressionMammalianPromoterCAGAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i1 sgRNA / hSpCas9
Plasmid#172825PurposeMammalian expression of a sgRNA targeting the intron 1 position 1 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSBK.014
Plasmid#187215PurposeExpresses retron Eco1 ncRNA v35 (long a1/a2, barcode 6 [CAG-CTG]), and Cas1 + Cas2DepositorInsertsRetron Eco1 ncRNA v35 (long a1/a2, barcode 6 [CAG-CTG])
Cas1 + Cas2
UseSynthetic BiologyExpressionBacterialPromoterT7/LacAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_rActb sgRNA / hSpCas9
Plasmid#172833PurposeMammalian expression of a sgRNA targeting the intron 1of rat Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of rActb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_rSyn1 sgRNA / hSpCas9
Plasmid#172840PurposeMammalian expression of a sgRNA targeting the intron 21 (last intron) of rSyn1 (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 21 of rSyn1 under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1401 Only mTagBFP2
Plasmid#253890PurposeIntegration Vector for AkaLuc-P2A-mTagBFP-P2A-BlastR reporter with CAG promoterDepositorInsertAkaLuc-P2A-mTagBFP-P2A-BlastR
UseSynthetic BiologyExpressionMammalianPromoterCAGAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSBK.011
Plasmid#187211PurposeExpresses retron Eco1 ncRNA v35 (long a1/a2, barcode 3 [CTG-CAG]), and Cas1 + Cas2DepositorInsertsRetron Eco1 ncRNA v35 (long a1/a2, barcode 3 [CTG-CAG])
Cas1 + Cas2
UseSynthetic BiologyExpressionBacterialPromoterT7/LacAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only