We narrowed to 23,402 results for: ESC
-
Plasmid#232580PurposeExpression of the Rnr S1 and basic domains (residues 1930 to 2442) as a GST-fusion.DepositorInsertRnr S1 + basic domain (residues 1930 to 2442)
TagsGSTExpressionBacterialAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRnr-CSD
Plasmid#232578PurposeExpression of the Rnr cold shock domains I and II (residues 1 to 648) as a GST-fusion.DepositorInsertRnr cold shock domains I and II (residues 1 to 648)
TagsGSTExpressionBacterialAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-All K-R
Plasmid#233094PurposeExpression of GST-YihI with all lysines (K) mutated to arginine (R)DepositorInsertGST-YihI with all lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationGST-YihI with all lysines (K) mutated to arginine…Available SinceMay 9, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-N-term S-A
Plasmid#233096PurposeExpression of GST-YihI with N-term serines (S) mutated to alanine (A)DepositorInsertYihI with N-term serines (S) mutated to alanine (A)
TagsGSTExpressionBacterialMutationN-term serines (S) mutated to alanine (A)Available SinceMay 7, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDM097
Plasmid#216819PurposeAspergillus nidulans codon-adjusted mStayGold fluorescent protein, includes linker for N-terminal or internal tagging.DepositorInsertmStayGold
TagsFLAG-(SGGS)x2-XTEN16-(GGGGS)x3 and c4-(GGGGS)x2-X…ExpressionBacterialMutationAspergillus nidulans codon-adjustedAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-tac-EcTyrRS-VSMA*-lpp-tRNA_CUA^EcTyr
Plasmid#218766Purposeencodes EcTyrRS-VSMA* and EcTyr-tRNA-TAGDepositorInsertEcTyrRS-VSMA*
ExpressionBacterialMutationY37V, D167G, D182S, F183M, L186A, D265RPromotertacIAvailable SinceJune 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWR23
Plasmid#202770Purposeepisomal bioluminescent reporter plasmid for S. stipitisDepositorInsertsTEF1 promoter (S. stipitis) (TEF1 S. stipitis (yeast))
coKanMX
ACT1 terminator (S. stipitis)
TDH3 promoter (S. stipitis)
coCBG
ADH2 terminator (S. stipitis)
ARS from S. stipitis chromosome 1
ExpressionYeastAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET21b-effector-ncRNA-rrt-His8
Plasmid#194089PurposeExpresses Ec86 operon (effector, ncRNA and reverse transcriptase) in Escherichia coliDepositorInsertEc86 effector-ncRNA-rrt
TagsHis8PromoterT7Available SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMamCol1
Plasmid#215184PurposeAllows for stable expression of recombinant (tagged/untagged) proteins in AAVS1 locus of Human cells and transient Protein Expression in E. coliDepositorInserttsPurple
UseAAV, CRISPR, and Synthetic Biology ; Recombinant …TagsSNAC-StrepII tagExpressionBacterial and MammalianPromoterTetON 3G Bidirectional for Mammalian and Trc with…Available SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_tKiMBImut-T2A-caMEK
Plasmid#199579PurposeExpress tKiMBImut(AA) and caMEK in an AAV vectorDepositorInsertsERK tdTomato-Kinase-Modulated Bioluminescent Indicator (mutant)
constitutively active MEK
UseAAVExpressionMammalianPromoterCMVAvailable SinceJune 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTP-PCR C4
Plasmid#189621PurposeCloned Reduced Mitochondrial Genome of the diatom Thalassiosira pseudonana in yeast and bacteriaDepositorInsertReduced Mitochondrial Genome of Thalassiosira pseudonana
UseSynthetic Biology; Diatom expressionExpressionBacterial and YeastMutationRepeat region removed, and minor additional mutat…Available SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
PlmdCas12e VPR
Plasmid#188516PurposeExpresses FLAG tagged PlmdCas12e fused to VPR (VP64-p65-Rta)DepositorInsertdCas12e
UseCRISPR and LentiviralTagsNLS-FLAG-VPRExpressionMammalianMutationD659A/E756A/D922APromoterEF1aAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmRE-Tn5-142
Plasmid#118531PurposeminiTn5 plasmid to deliver constitutively expressed fluorescent protein genes in bacteriaDepositorInsertmClover3
UseMinitn5 delivery vectorExpressionBacterialAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2393-Tier1-PhCMV-p2a_fastFT
Plasmid#169530PurposeTier-1 vector encoding PhCMV-driven delayed-maturing fluorescent protein fluorescent timer (FT) with "fast" maturation fastFT fused to a "self-cleaving" peptide p2a (PhCMV-p2a_medFT-pA).DepositorInsertPCMV-driven P2A-fused fluorescent timer, fast maturation time
ExpressionMammalianPromoterPhCMVAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2392-Tier1-PhCMV-p2a_medFT
Plasmid#169529PurposeTier-1 vector encoding PhCMV-driven delayed-maturing fluorescent protein fluorescent timer (FT) with "medium" maturation medFT fused to a "self-cleaving" peptide p2a (PhCMV-p2a_medFT-pA).DepositorInsertPCMV-driven P2A-fused fluorescent timer, medium maturation time
ExpressionMammalianPromoterPhCMVAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FluoSTEP-AKAR (C/Y)
Plasmid#181862PurposeFluoSTEP-AKAR using split CFP and cpVenus(E172) as the FRET donor and acceptor. Must pair with GFP11-tagged POI to reconstitute donor fluorescence.DepositorInsertFluoSTEP-AKAR (C-Y)
TagsCFP(1-10) and cpVenus(E127)ExpressionMammalianPromoterCMVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPEE44
Plasmid#139423PurposeRecyclable marker for use in Cryptococcus neoformans. Contains the amdS2 counterselectable marker flanked by the mTFP1 ORF and a flexible linker at the 5' end.DepositorInsertmTFP1
ExpressionYeastPromoterTEF1Available SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
Antares-SEPLuc C1A4E
Plasmid#141088Purposeprecursor of the bioluminescent reporter pHluc, for detecting extracellular pH changes in tumor acidosis; utilizes weaker mutant of IRES and weaker precursor of NanolucDepositorInsertAntares-T2A-puromycin-IRESv24-SEP-C1A4E
ExpressionMammalianMutationPlease see depositor commentsPromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only