We narrowed to 7,615 results for: Trac
-
Plasmid#182969PurposeStably express PalmNanoLuc in mammalian cells via the sleeping beauty transposon system.DepositorInsertPalmNanoLuc
ExpressionMammalianMutationN/AAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(L, del13)-AP-His
Plasmid#72011PurposeExpresses the Sema3A protein (truncated at cleavage site P3; ie, long and missing exon 13), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
dmBACCS2VL-IRES-dOrai-IRES-mCherry
Plasmid#72898PurposeMammalian expression of dmBACCS2VL, a modified Drosophila melanogaster blue light-activated Ca2+ channel switch, along with dOrai and mCherryDepositorInsertdmBACCS2VL-IRES-dOrai-IRES-mCherry
TagsIRES-mCherryExpressionMammalianPromoterCMVAvailable SinceJan. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-1 3xHA-MKK7a1-EE
Plasmid#47578PurposeBacterial expression plasmid for GST-3xHA-tagged constitutively active MKK7a1DepositorInsertMKK7a1-EE (Map2k7 Mouse)
Tags3xHA and GSTExpressionBacterialMutationResidues 73-420 of RefSeq sequence. Ser271 to Gl…Available SinceAug. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
dmBACCS2NS-IRES-dOrai-IRES-mCherry
Plasmid#72896PurposeMammalian expression of dmBACCS2NS, a modified Drosophila melanogaster blue light-activated Ca2+ channel switch, along with dOrai and mCherryDepositorInsertdmBACCS2NS-IRES-dOrai-IRES-mCherry
TagsIRES-mCherryExpressionMammalianPromoterCMVAvailable SinceJan. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
mVenus-NES-SspB-ITSN1-DHPH-P2A-iLIDcaax
Plasmid#173866PurposeMammalian expression of mVenus-NES-SspB-ITSN1-DHPH-P2A-iLIDcaax (opto-Cdc42)DepositorInsertmVenus-NES-SspB-ITSN1-DHPH-P2A-iLIDcaax
TagsC-terminal CAAX-box and mVenusExpressionMammalianPromoterCMVAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
MO70 - Orai1 EC-Flag
Plasmid#79590PurposeTransient expression and retroviral ExpressionDepositorInsertOrai1 (ORAI1 Human)
UseRetroviralTagsFLAG (inserted between TM3 and TM4 of the protein…ExpressionMammalianPromoterCMVAvailable SinceAug. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema3f(L,+)-Fc-His
Plasmid#72147PurposeExpresses the Sema3F protein (truncated at cleavage site P3; ie, long and contains no deletion in exon 3), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(L, del3)-AP-His
Plasmid#72010PurposeExpresses the Sema3A protein (truncated at cleavage site P3; ie, long and missing exon 3), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-MKL1 D301-380
Plasmid#19852DepositorAvailable SinceDec. 16, 2008AvailabilityAcademic Institutions and Nonprofits only -
pBS-Squ5'3'
Plasmid#20165DepositorInsertspaghetti squash (squ, myosin II RLC) 5' UTR, ORF (without stop codon) and 3' UTR with multiple cloning site downstream (sqh Fly)
ExpressionBacterialAvailable SinceApril 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pTBL1401 pLenti-pEF1a(short)-mNeonGreen-P2A-Cas9
Plasmid#163644PurposeMakes a lentivirus that expresses mNeonGreen and Cas9.DepositorInsertmNeonGreen-P2A-Cas9
UseLentiviralTagsmNeonGreen-P2APromoterEFSAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(S)-AP-His
Plasmid#72012PurposeExpresses the Sema3A protein (truncated at cleavage site P1; ie, short), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pB80-SSPB(micro)-mVenus-GCN4-ppKin14VIb(861-1321)
Plasmid#174642PurposeOptogenetic coupling to tetramerized moss kinesin-14 via SSPB(micro) for highly efficient retrograde transportDepositorInsertSSPB(micro)-mVenus-GCN4-ppKin14VIb(861-1321)
TagsSSPB(micro)-VenusExpressionMammalianMutationSSPB:Arg73Gln; mVenus: Met1Del, Thr154Met; ppKin1…PromoterChicken beta-actinAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
Sema3b(L)-AP-His
Plasmid#72013PurposeExpresses the Sema3B protein (truncated at cleavage site P3; ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCin4-3xFLAG-MKL1 D444-500
Plasmid#19839DepositorInsertMKL1 D444-500 (MRTFA Human)
Tags3xFLAGExpressionMammalianMutationdeleted amino acids 444-500Available SinceMarch 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE1-gRNA#3
Plasmid#107728PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO myc p31Comet
Plasmid#59833PurposeAllows the integration of myc p31Comet in the genome and Tet-inducible expression.DepositorInsertp31 (MAD2L1BP Human)
TagsMycExpressionMammalianPromoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only