We narrowed to 9,366 results for: tre promoter
-
Plasmid#25958DepositorInsertHypoxia inducible factor 2 alpha (EPAS1 Human)
UseRetroviralTagsHA-tagExpressionMammalianMutationcDNA changed amino acids: Proline 405 to Alanin…Available SinceSept. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCR-XL-rAkap9
Plasmid#196867PurposeCloned rat (r) A-Kinase Anchoring Protein 9 (Akap9) ORF. Used as a template for Akap9 containing constructsDepositorAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
p2K7bsdUBI-mCherry-STIM1
Plasmid#114178PurposeLentiviral vector for expression of mCherry-STIM1DepositorInsertSTIM1 (STIM1 Human)
UseLentiviralTagsmCherry (inserted after signal peptide)ExpressionMammalianPromoterUbiquitinAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-HNF1A-WT-Flag-UTR
Plasmid#183237PurposeExpression of FLAG tagged HNF1ADepositorAvailable SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIRIGF-IKZF1-V2
Plasmid#69045Purposeexpression of IKZF1 fused to firefly luciferase with co-expression of Renilla luciferase, both under IRES control.DepositorInsertIKZF1 (IKZF1 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationsplice variant 2PromoterIRESAvailable SinceOct. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR1a-mCherry-STIM1
Plasmid#114176PurposeGateway entry clone containing mCherry-STIM1DepositorAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
HA-HIF2α P405A/P531A/N847A-pBabe-Puro
Plasmid#25956DepositorInsertHypoxia inducible factor 2 alpha (EPAS1 Human)
UseRetroviralTagsHA-tagExpressionMammalianMutationcDNA changed amino acids: Proline 405 to Alanin…Available SinceOct. 19, 2010AvailabilityAcademic Institutions and Nonprofits only -
plenti-CAG-IKZF1-V1-Q146H-FLAG-IRES-GFP
Plasmid#69048Purposelentiviral expression of IKZF1 variant 1 with Q146H mutation and FLAG tagDepositorInsertIKZF1 (IKZF1 Human)
UseLentiviralTagsFLAG and IRES-GFPExpressionMammalianMutationsplice variant 1, Q146HPromoterCAGAvailable SinceOct. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-PCAF (delta5-53a.a.)
Plasmid#65388PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorInsertPCAF (KAT2B Human)
TagsEmGFP and V5ExpressionMammalianMutationlost 13-159bp of the ORFPromoterCMVAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
HA-HIF2α P405A/P531A/N847Q-pBabe-Puro
Plasmid#25948DepositorInsertHypoxia inducible factor 2 alpha (EPAS1 Human)
UseRetroviralTagsHA-tagExpressionMammalianMutationcDNA changed amino acids: Proline 405 to Alanin…Available SinceSept. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
MSCV-HA-Nr4a1-AA
Plasmid#160942PurposeGeneration of retrovirus for the overexpression of Nr4a1 mutant (287C 288EAA)DepositorInsertNr4a1 (Nr4a1 Mouse)
UseRetroviralTagsHA tagExpressionMammalianMutationChange Cys 287 Glu 288 into Ala AlaPromoterMSCV-LTRAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
Flag-KLF6-4D (1054)
Plasmid#49490Purposeexpresses human Flag tagged KLF6 with 4D mutationDepositorInsertKFL6-4D (KLF6 Human)
TagsFlagExpressionMammalianMutationthree serines and one tyrosine mutated to aspart…PromoterCMVAvailable SinceFeb. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-RASA1-3'UTR
Plasmid#62575PurposeTranslational Luciferase Reporter containing a 926 bp fragment of the RASA1 3'UTR.DepositorAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K5S-Mt344A
Plasmid#34601DepositorInsertKLF4 (KLF4 Human)
UseLuciferaseExpressionMammalianMutationThe KLF4 K5S region was mutated at the miR-344 bi…PromoterCMVAvailable SinceFeb. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K5S-Mt206B
Plasmid#34600DepositorInsertKLF4 (KLF4 Human)
UseLuciferaseExpressionMammalianMutationThe KLF4 K5S region was mutated at the miR-206 bi…PromoterCMVAvailable SinceFeb. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
SB-CAG-mCherry-P2A-EIF3D-DD-IP
Plasmid#236770PurposeA sleeping beauty-based vector containing CAG promoter-driven mCherry-P2A-EIF3D S528D/S529D-IRES-Pac.DepositorInsertEIF3D (EIF3D Human)
UseSleeping beautyExpressionMammalianMutationchanged Serine 528 to Aspartic Acid and Serine 52…PromoterCAG promoterAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
ST-2xTstem(5A)-GFP
Plasmid#162504PurposeExpresses a ST6GAL1 mutant with a GFP tag in its C-terminus in mammalian cells. One wildtype Tac stem region is inserted within ST and the other mutated Tac stem region is inserted between ST and GFP.DepositorTagsGFPExpressionMammalianMutationOne Tac stem region is inserted within ST6Gal1 an…Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
ST-2xTstem-GFP
Plasmid#162503PurposeExpresses a ST6GAL1 mutant with a GFP tag in its C-terminus in mammalian cells. One Tac stem region is inserted within ST and the other Tac stem region is inserted between ST and GFP.DepositorTagsGFPExpressionMammalianMutationOne Tac stem region is inserted within ST6Gal1 an…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only