We narrowed to 8,907 results for: Ott
-
Plasmid#162876PurposeExpression in mammalian cells of GFP binding protein (GBP) tagged with photoconvertable protein mEos2 to track GFP proteins of interest to perform Fluorescent intrabody Localization MicroscopyDepositorInsertGFP Binding Protein tagged with mEos2
TagsmEos2ExpressionMammalianAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCW-eGFP-SHLD3
Plasmid#114126PurposeLentiviral vector for inducible expression of N-terminally tagged eGFP-tagged SHLD3DepositorInsertSHLD3 (SHLD3 Human)
UseLentiviral; Doxycycline inducibleTagseGFPExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceAug. 28, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV-T7-BPNLS-ABE8e-iSpyMac-BPNLS-P2A-EGFP (LLH528)
Plasmid#208289PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with iSpyMac(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-iSpyMac-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA; mutations in iSpyMacPromoterCMV and T7Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pINTO-N3::hTET3 HxD
Plasmid#136365PurposeExpresses epitope-tagged human TET3 catalytically dead (HxD mutation) in mammalian cellsDepositorInsertTET3 (TET3 Human)
Tags2xStrepTagII, FLAG, and HAExpressionMammalianMutationHxD (H1077Y, D1079A)Available SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEMS1951
Plasmid#105868PurposeHigh copy number plasmid containing Hspa1a (synonym Hsp68) MiniPromoter insertDepositorAvailable SinceFeb. 22, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKLV2-U6gRNA5(gBFP)-PGKGFP2ABFP-W
Plasmid#67984PurposeCas9 activity reporter with GFP and BFPDepositorInsertsU6gRNA cassette, PGKGFP2ABFP cassette, WPRE
Guide RNA targeting modified BFP
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT2K-p53DN-T2A-copGFP
Plasmid#109229PurposeFor Tol2 transposon-mediated stable expression of dominant negative p53 and copGFPDepositorInsertdominant negative p53 (Trp53 Mouse)
TagscopGFPExpressionMammalianMutationdominant negative p53PromoterCAGGSAvailable SinceMay 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-46: MYL7-mEGFP
Plasmid#114413PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human MYL7, via Cas9-excisable CAGGS-mCherry selection cassetteDepositorInsertMYL7 Homology Arms with linker-mEGFP and Cas9-excisable selection cassette (MYL7 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
miniTol2 x EF1a_EKAREN5 + PGK-puro
Plasmid#167817PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN5
Tagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
TRIP12-V2_A755-A841
Plasmid#194759PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceJuly 19, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTBL716 4xHRE-YB-TATA-Cas9-ODD-T2A-TdT
Plasmid#132667PurposeExpresses hypoxia-inducible Cas9 and TdT in mammalian cells.DepositorInsertCas9-ODD-T2A-TdT (DNTT Human, Streptococcus pyogenes)
ExpressionMammalianPromoter4xHRE_YB TATAAvailable SinceNov. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA3(BbsI)-PGKpuro2ABFP
Plasmid#67990PurposeCRISPR gRNA expression vector with the conventional scaffold and puro/BFP markers without WPREDepositorInsertU6gRNA cassette with the conventional scaffold, PGKpuro2ABFP cassette
UseCRISPR and LentiviralAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-TadCBEd-SpCas9-P2A-EGFP (BKS327)
Plasmid#223123PurposepCMV and pT7 Human expression plasmid for TadCBEd-SpCas9 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadCBEd-SpCas9-2xUGI-P2A-EGFP
UseCRISPRTags2xUGI-BPNLS-P2A-EGFP and BPNLS-TadA-CDdExpressionMammalianMutationTadA-CDd mutations; nSpCas9=D10APromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-PEmax-P2A-EGFP (LM1589)
Plasmid#223136PurposepCMV and pT7 Human expression plasmid for PEmax(nSpCas9(H840A)-M-MMLV_RT**)-P2A-EGFPDepositorInserthuman codon optimized PEmax-P2A-EGFP
UseCRISPRTagsBPNLS and NLS(SV40)-NLS(cMyc)-P2A-EGFPExpressionMammalianMutationM-MLV mutations from PE2 (Anzalone et al. Nature …PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-BPNLS-CE-ABE8e-SpCas9(D10A)-BPNLS-P2A-EGFP (NK350)
Plasmid#208292PurposeCMV and T7 promoter expression plasmid for human codon optimized CE-ABE8e-SpCas9 A-to-G base editor and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-CE-ABE8e-SpCas9-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA inlaid into nSpCas9(D10A)PromoterCMV and T7Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR207 SARS-CoV-2 NSP1 Delta RC
Plasmid#164522PurposeGateway-compatible Entry vector, with insert of mutated NSP1 CDS from SARS-CoV-2 isolate Wuhan-Hu-1 (amino acid substitutions K164A/H165A)DepositorInsertNSP1 Delta RC (ORF1ab )
ExpressionMammalianMutationInsert of NSP1 gene's CDS from SARS-CoV-2 is…Available SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-HA-RAD52-∆C
Plasmid#235677PurposeExpresses HA-tagged mutant human RAD52 in mammalian cells with a C-terminal deletion (Δ302-410 amino acids).DepositorAvailable SinceApril 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT2K-LRL-mouse c-MYC-IRES-Luc2
Plasmid#109228PurposeFor Tol2 transposon-mediated stable expression of LRL, c-Myc and IRES-luciferaseDepositorAvailable SinceJune 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti PGK mKate2-OGT D554N (Puro)
Plasmid#154292PurposeLentiviral vector encoding full length mKate2-2xFLAG-OGT (full length human O-GlcNAc transferase, D554N variant, no Ser/Thr glycosylation)DepositorInsertO-GlcNAc Transferase (OGT Human)
UseLentiviralTags2x FLAG and mKate2ExpressionMammalianMutationD554N mutation (Ser/Thr glycosylation-incompetent)PromoterPGKAvailable SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn syph-GFP-myc-BoNT/B(1-146)-iLID
Plasmid#122981PurposeAAV plasmid with human synapsin promoter driving synaptophysin fused to GFP, iLID(V416I) and BoNT/B amino acids 1-146. Co-express with SSPB-BoNT(147-441, Y365A) for vPA-BoNTDepositorInsertSyph-GFP-myc-BoNT/B(1-146)-iLID (Syp Rat, Synthetic)
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsinAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN4-ires-blast
Plasmid#167829PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN4
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-HA-UbvG08-IRES-GFP
Plasmid#75030PurposeRetroviral vector with ubiquitin variant that binds to and occludes the ligand binding site of the 53BP1 Tudor domain (i53)DepositorInsertUbiquitin
UseRetroviralTagsHA and IRES-eGFPMutationUbvG08 with I44A mutation and no terminal GlycinesAvailable SinceJune 30, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pOPINO_H3
Plasmid#171927PurposeBacterial expression of nanobody VHH_H3, which binds to receptor binding domain of the spike protein of SARS-CoV-2DepositorInsertVHH_H3
TagsHis6ExpressionBacterial and MammalianAvailable SinceSept. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-i53-DM
Plasmid#92171Purposerecombinant adeno-associated viral plasmid for delivery and expression of ubiquitin variant that has reverted mutations L69P and V70L (i53-DM)DepositorInserti53-DM
UseAAVTagsFLAGExpressionMammalianMutationUbvG08 with I44A, P69L, and L70V mutations and no…PromoterCMVAvailable SinceJuly 13, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCR8-Magneto2.0-p2A-mCherry
Plasmid#74334PurposeFor gateway cloning Magneto2.0-p2A-mCherry into destination vectorDepositorUseGateway vectorTagsFlag and p2A-mCherryMutationTRPV4: delta 760–871PromoternoneAvailable SinceMay 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y2B)-PGKpuro2AmCherry-W
Plasmid#163179PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of mCherry tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-HA-UbvG08_MUT-IRES-GFP
Plasmid#75031PurposeRetroviral vector with ubiquitin variant with reverted mutations L69P and V70L (i53-DM mutant)DepositorInsertUbiquitin
UseRetroviralTagsHA and IRES-eGFPMutationUbvG08 with I44A, P69L, and L70V mutations and no…Available SinceJune 30, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKLV2-U6gRNA5(hWWTR1-W1K)-PGKpuro2AmCherry-W
Plasmid#163176PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of mCherry tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-V5-SHLD3
Plasmid#114124PurposeExpresses N-terminally tagged V5-SHLD3 in mammalian cellsDepositorInsertSHLD3 (SHLD3 Human)
UseGenomic integration, tetracycline inducibleTagsV5ExpressionMammalianPromoterCMV/TetO2Available SinceAug. 23, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3-Flag::UbvG08 P69L, L70V, I44A, deltaGG
Plasmid#74940PurposeUbiquitin variant with mutations L69P and V70L reverted to wild type (i53-DM mutant)DepositorInsertUbiquitin
TagsFlagExpressionMammalianMutationUbvG08 with I44A, P69L, and L70V mutations and no…PromoterCMVAvailable SinceMay 13, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pOPINO_C5
Plasmid#171925PurposeBacterial expression of nanobody VHH_C5, which binds to receptor binding domain of the spike protein of SARS-CoV-2DepositorInsertVHH_C5
TagsHis6ExpressionBacterialAvailable SinceSept. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti PGK mKate2-OGT 5N5A (Puro)
Plasmid#154293PurposeLentiviral vector encoding full length mKate2-2xFLAG-OGT (full length human O-GlcNAc transferase, 5N5A variant, no HCF-1 cleavage)DepositorInsertO-GlcNAc Transferase (OGT Human)
UseLentiviralTags2x FLAG and mKate2ExpressionMammalianMutationN322A, N356A, N390A, N424A, N458A mutations; HCF-…PromoterPGKAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Empty)-PGKGFP2ABFP-W
Plasmid#67983PurposeCas9 activity reporter (control) with GFP and BFPDepositorInsertU6gRNA cassette, PGKGFP2ABFP cassette, WPRE
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
6MIW
Plasmid#127291PurposeBacterial expression for structure determination. May not contain entire coding region of geneDepositorAvailable SinceJune 18, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pOPINO_C1
Plasmid#171924PurposeBacterial expression of nanobody VHH_C1, which binds to receptor binding domain of the spike protein of SARS-CoV-2DepositorInsertVHH_C1
TagsHis6ExpressionBacterialAvailable SinceSept. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA-Cas9-T2A-STOP-TdT
Plasmid#126425PurposeExpresses Cas9 but not TdT in mammalian cells; control for pcDNA-Cas9-T2A-TdT. (pTBL552)DepositorInsertCas9-T2A-STOP-TdT (DNTT Human, Streptococcus pyogenes)
ExpressionMammalianMutationalanine-6 of TdT has been changed to a STOP codonPromoterpCMVAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9-HiFi-P2A-EGFP (LM446)
Plasmid#197506PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpCas9-HiFi(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-nSpCas9-HiFi-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpCas9-HiFi(D10A/R69…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOPINO_F2
Plasmid#171926PurposeBacterial expression of nanobody VHH_F2, which binds to receptor binding domain of the spike protein of SARS-CoV-2DepositorInsertVHH_F2
TagsHis6ExpressionBacterial, Insect, and Mamm…Available SinceSept. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
miniTol2 x EF1a_EKAREN5(TA) + PGK-puro
Plasmid#167819Purposecontrol sensor for EKAREN5DepositorInsertEKAREN5(TA)
Tagsnls localization motifExpressionMammalianMutationK424P, K426W, T420APromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only