We narrowed to 171,035 results for: Gene
-
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
SL542
Plasmid#49951PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
SL544
Plasmid#49970PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL545
Plasmid#49953PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL543
Plasmid#49952PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL541
Plasmid#49950PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL540
Plasmid#49949PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCIneoEGFP
Plasmid#46949PurposeGFP in Promega pCIneo (uses CMV promoter). Superior to pfwB for some purposesDepositorInsertGFP
ExpressionMammalianPromoterCMVAvailable SinceAug. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pUK21
Plasmid#49788PurposeE. coli cloning vector (KanR, high copy, blue/white selection, M13 IR)DepositorTypeEmpty backboneUseCloning vectorPromoterlacZAvailable SinceJuly 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
372 pTol2-fli1ep:EGFPDest
Plasmid#73491PurposeTol2 vector with fli1ep element upstream of EGFP, attR1/R2 cassette, and late SV40 pA signalDepositorInsertfli1ep:EGFP-attR1-attR2
Available SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAP1-3
Plasmid#71258Purposeluciferase reporter with 3 copies of the stromelylisin gene AP-1 site in front of hGM-CSF -55 to +28 minimal promoterDepositorInsert3 copies of an AP-1 site from the human Stromelysin-1 gene (MMP3 Human)
UseLuciferaseTagsluciferaseExpressionMammalianPromoterGM-CSF minimalAvailable SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBI-MCS-EGFP
Plasmid#16542DepositorTypeEmpty backboneExpressionMammalianAvailable SinceJune 11, 2008AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-NlucP
Plasmid#162595PurposeC-terminally PEST-tagged NanoLuc under TRE3G promoterDepositorInsertNanoLuc-PEST
TagsPESTExpressionMammalianPromoterTRE3G promoterAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQFT-mNG
Plasmid#203675PurposepQFT with mNeonGreen under control of PQJDepositorInsertmNeonGreen
ExpressionBacterialPromoterPQJAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLZts
Plasmid#128799PurposeTemperature-sensitive vector for allelic replacement mutagenesis of Group A StreptococcusDepositorTypeEmpty backboneUseBacterial mutagenesisAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Gateway
Plasmid#32671DepositorTypeEmpty backboneUseAAV; AavAvailable SinceJune 29, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJG/ALPHA MHC
Plasmid#55594Purposetransgene expression driven by ALPHA MHC promoterDepositorTypeEmpty backboneExpressionMammalianPromoteralpha MHCAvailable SinceJuly 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4
Plasmid#133783PurposeLibrary backboneDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHM4 (U6 in pSE360)
Plasmid#111281PurposeU6 snRNA coding sequence in pSE360(Ura) plasmidDepositorInsertSNR6
ExpressionYeastAvailable SinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIB2
Plasmid#25451DepositorInsertPichia pastoris HIS4 (PAS_chr1-4_0160 Pichia pastoria)
UsePichia pastoris expressionAvailable SinceJuly 14, 2010AvailabilityAcademic Institutions and Nonprofits only