We narrowed to 11,068 results for: AGA
-
Plasmid#133356PurposePiggybac vector for CRISPR/SpCas9 applications (nuclease, base editing, or epigenetic modifications) coexpressed with tdTomato-NLSDepositorInserttdTomato-NLS
TagsHA-tagged tdTomatoExpressionMammalianMutationN/APromoterCMV enhancer and hEf1a (CpG free)Available SinceJan. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
HCP5
Plasmid#166107PurposeThis plasmid encodes a Cas9 protein as well as a sgRNAs that targets the C-terminus of Cyr1.DepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSB700-ACTC1-Puro
Plasmid#128324PurposeSP-dCas9 compatible gRNA to be used as a positive control for activation experiments (human cells)DepositorInsertgRNA against human ACTC1
ExpressionMammalianAvailable SinceAug. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSC49
Plasmid#104823PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma17g11235 (Dcl4a). Also expresses Cas9 from AtUBQ10 promoter.DepositorInsertGlyma17g11235
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pICSL61002
Plasmid#245679PurposeLevel 0 Golden Gate part HSP18 (TerP1) terminator P1, GCTT - TAGADepositorInsertHSP18 (TerP1) terminator P1
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL61004
Plasmid#245681PurposeLevel 0 Golden Gate part 3' Extensin-Truncated-EU (TerP1) terminator P1, GCTT - TAGADepositorInsert3' Extensin-Truncated-EU (TerP1) terminator P1
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL62001
Plasmid#245682PurposeLevel 0 Golden Gate part Nos (TerP2) terminator P2, TAGA - CGCTDepositorInsertNos (TerP2) terminator P2
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL62003
Plasmid#245684PurposeLevel 0 Golden Gate part 3' Extensin-Truncated (TerP2) terminator P2, TAGA - CGCTDepositorInsert3' Extensin-Truncated (TerP2) terminator P2
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL62005
Plasmid#245686PurposeLevel 0 Golden Gate part NbHSP18.2 (TerP2) terminator P2, TAGA - CGCTDepositorInsertNbHSP18.2 (TerP2) terminator P2
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL62004
Plasmid#245685PurposeLevel 0 Golden Gate part NbACT (TerP2) terminator P2, TAGA - CGCTDepositorInsertNbACT (TerP2) terminator P2
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL61001
Plasmid#245678PurposeLevel 0 Golden Gate part 35S (TerP1) terminator P1, GCTT - TAGADepositorInsert35S (TerP1) terminator P1
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ15-PB-U6-Nkx6.1-acti-gRNA1
Plasmid#131059PurposeActivation of NKX6.1 via SAM systemDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ17-PB-U6-Nkx6.1-acti-gRNA3
Plasmid#131061PurposeActivation of Mafa via SAM systemDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS 2comp Donor;smFP-V5 KO;Gphn#2
Plasmid#240308PurposeDonor:smFP-V5 KO:Gphn#2DepositorInsertKO gRNAs for Gphn
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
HCP7
Plasmid#166109PurposeThis plasmid encodes a Cas9 protein as well as two sgRNAs, one targets the C-terminus of Whi5 and the other targets the C-terminus of Hta2.DepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPATZ1.1.0-gDNA
Plasmid#132476PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertPATZ1 (PATZ1 Human)
UseCRISPRAvailable SinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF302.1.0-gDNA
Plasmid#132467PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZNF302 (ZNF302 Human)
UseCRISPRAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ Rac4
Plasmid#126884PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Dja6_2
Plasmid#126895PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Rac4
Plasmid#126896PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ ERF922
Plasmid#126893PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSA_0_mKate2_synCoTC
Plasmid#199469PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorArticleInsertmKate2
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
Phage-PGK-GFP-T(WT)
Plasmid#181736Purposefor lentiviral expression of brachyury ORF in mammalian cellsDepositorInsertT (brachyury)
UseLentiviralMutationa silent mutation in the PAM site of an sgRNAt ta…Available SinceAug. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB700-mouse-TTN-Cerulean
Plasmid#128325PurposeSP-dCas9 compatible gRNA to be used as a positive control for activation experiments (mouse cells)DepositorInsertgRNA against mouse TTN for activation
ExpressionMammalianAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSA_2_mKate2_synCoTC
Plasmid#199471PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorArticleInsertmKate2
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSA_2_mTagBFP2_synCoTC
Plasmid#199474PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorArticleInsertmTagBFP2
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSA_0_mTagBFP2_synCoTC
Plasmid#199472PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorArticleInsertmTagBFP2
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426TEF-LptTPS-A
Plasmid#89468PurposeExpression of prespatane synthase LptTPS-A in S. cerevisiae for sesquiterpene productionDepositorInsertLptTPS-A
TagsnoneExpressionYeastPromoterpBR322 origin of replication for propagation in E…Available SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSA_1_mKate2_synCoTC
Plasmid#199470PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorArticleInsertmKate2
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSA_1_mTagBFP2_synCoTC
Plasmid#199473PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorArticleInsertmTagBFP2
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNT-hU6-sgNeo2
Plasmid#177231PurposeExpresses neomycin gRNA's ( bU6 and hU6 ), non-targeting gRNA ( mU6 ) and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgNeo2
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
Phage-PGK-FLAG-HA-T(WT)
Plasmid#181737Purposefor lentiviral expression of brachyury ORF in mammalian cellsDepositorInsertT (brachyury)
UseLentiviralMutationa silent mutation in the PAM site of an sgRNAt ta…Available SinceAug. 3, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
GAPDH shRNA #1
Plasmid#32621DepositorInsertGAPDH shRNA #1
UseRNAiAvailable SinceJan. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pICSL61003
Plasmid#245680PurposeLevel 0 Golden Gate part 3' Extensin-Full length-IEU (TerP1) terminator P1, GCTT - TAGADepositorInsert3' Extensin-Full length-IEU (TerP1) terminator P1
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL62002
Plasmid#245683PurposeLevel 0 Golden Gate part3' Extensin-Full length (TerP2) terminator P2, TAGA - CGCTDepositorInsert3' Extensin-Full length (TerP2) terminator P2
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYJ14-PB-U6-ND1-acti-gRNA3
Plasmid#131058PurposeActivation of NeuroD1 via SAM systemDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shATF4 #1
Plasmid#242702PurposeshRNA knockdown human ATF4 geneDepositorInsertATF4 (ATF4 Human)
UseLentiviralAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKozak_mTagBFP2_synCoTC
Plasmid#199493PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTCDepositorArticleInsertmTagBFP2
UseCRISPRAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-TMPRSS2-A5
Plasmid#188689PurposesgRNADepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
HCP1
Plasmid#166103PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombination.DepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP2
Plasmid#166104PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombinationDepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP3
Plasmid#166105PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombinationDepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_LHS1
Plasmid#166092PurposePlasmid for constituive spCas9 and tet-inducible LHS1 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_YBL055C
Plasmid#166077PurposePlasmid for constituive spCas9 and tet-inducible YBL055C targeting sgRNA expression for double stranded break formation in yeastDepositorInsertYBL055C (near PTC3) (YBL055C Budding Yeast)
UseCRISPRExpressionYeastPromoterTet-inducibleAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_PPE1
Plasmid#166083PurposePlasmid for constitutive spCas9 and tet-inducible PPE1 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only