We narrowed to 14,061 results for: CAN
-
Plasmid#178981PurposepACYC Duet-1 containing full Type III-E system Candidatus “Scalindua brodae” CRISPR arrayDepositorInsertCRISPR array from Candidatus Scalindua brodae
ExpressionBacterialPromoterT7Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBabe_puro_DEST_Flag_PRKCI
Plasmid#45263DepositorAvailable SinceJune 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRShygro shID3#1
Plasmid#19164DepositorInsertsmall hairpin RNA against inhibitor of DNA binding 3 (ID3 Human)
UseRNAi and RetroviralExpressionMammalianAvailable SinceSept. 16, 2008AvailabilityAcademic Institutions and Nonprofits only -
pSUPER.retro BRIT1
Plasmid#16206DepositorAvailable SinceNov. 21, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBabe_puro_DEST_Flag_TLOC1 (220aa)
Plasmid#45273DepositorAvailable SinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGL2 p15 4xSBR2 MutSBE
Plasmid#15707DepositorInsertp15 4xSBR2 (CDKN2B Human)
UseLuciferaseExpressionMammalianMutationMutant SBE (Smad binding element)Available SinceSept. 7, 2007AvailabilityAcademic Institutions and Nonprofits only -
Flag-TRIM24-C840W shRescue
Plasmid#28137DepositorInsertTRIM24 (TRIM24 Human)
TagsFLAGX2ExpressionMammalianMutationC840Wmutated at aa 308 and 309 for shRNA rescue; …Available SinceFeb. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGL2 p15 4xSBR1 MutSBE
Plasmid#15718DepositorInsertp15 4xSBR1 (CDKN2B Human)
UseLuciferaseExpressionMammalianMutationMutant SBE (Smad binding element)Available SinceSept. 7, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBK-EcTrpRS(H14)
Plasmid#231129PurposeExpresses mutant E. coli TrpRS from a weak glnS promoter for proteome-wide incorporation of tryptophan analogues.DepositorInsertE. coli tryptophanyl tRNA synthetase
ExpressionBacterialMutationS8A, V144G, V146CAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBBR1-EcTrpRS(H14)
Plasmid#231131PurposeExpresses mutant E. coli TrpRS from a derepressed lac promoter for proteome-wide incorporation of tryptophan analogues in E. coli/K. pneumoniae.DepositorInsertE. coli tryptophanyl tRNA synthetase
UseKlebsiella pneumoniae expressionExpressionBacterialMutationS8A, V144G, V146CAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSGAb/pEvol-AbTrpRS(H14)
Plasmid#231133PurposeExpresses mutant A. baumannii TrpRS from an inducible lac promoter for proteome-wide incorporation of tryptophan analogues.DepositorInsertA. baumannii tryptophanyl tRNA synthetase
UseAcinetobacter baumannii expressionExpressionBacterialMutationT12A, V151G, V153CAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-p53-G609T
Plasmid#229531PurposeExpresses p53 mutant CASM203 in mamallian cellsDepositorAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-p53-G609A
Plasmid#229532PurposeExpresses p53 mutant G609A in mamallian cellsDepositorAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-p53-G609C
Plasmid#229533PurposeExpresses p53 mutant G609C in mamallian cellsDepositorAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
FLAG-MKI-P2A-GFP
Plasmid#229405PurposeLentiviral or overpexression of cDNADepositorInsertMKI-P2A-GFP
UseLentiviralTagsFLAGExpressionMammalianPromoterEFSAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTE5418_pMBP-GlcR
Plasmid#221192PurposeExpression vector for 10x-MBP-GlcR (MGlcR). GlcR is a glycolate-responsive transcriptional repressor and the gene product of pden4400 from Paracoccus denitrificans, codon optimized for E. coli.DepositorInsertglcR (pden4400 from Paracoccus denitrificans)
Tags10x His tag with E. coli maltose binding protein …ExpressionBacterialPromoterT7 promoter and T7 promoter-lacOAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
Efg1-ΔDBD-A51P/A56P/Q70P/Q443P
Plasmid#216403PurposeExpresses 6xHis-tagged N- and C-terminal prion-like domains of Efg1 with A51/A56/Q70P/Q443 to proline mutationsDepositorInsertEfg1-ΔDBD-A51P/A56P/Q70P/Q443P
Tags6xHis-tagsExpressionBacterialMutationchanged Alanine 51, 56 and Glutamine 70, 443 to P…Available SinceApril 17, 2024AvailabilityAcademic Institutions and Nonprofits only