We narrowed to 79,113 results for: rest
-
Plasmid#127647PurposeKnock-down of human STINGDepositorInsertSTING shRNA (STING1 Human)
UseLentiviralAvailable SinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR-ABCC1_STOP
Plasmid#221423PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertABCC1 (ABCC1 Human)
ExpressionMammalianAvailable SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA CFP hNKCC1 WT (NT15-H)
Plasmid#49077PurposeExpresses human NKCC1 with an N-terminal 3xHA-CFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites. Native hNKCC1 amino acid sequenceDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x HA and mCeruleanExpressionMammalianMutation262 silent mutations from native hNKCC1PromoterCMVAvailable SinceNov. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pENTR-HLA-A0201-His
Plasmid#108213PurposeHLA-A0201 his taggedDepositorInsertmajor histocompatibility complex, class I, B (HLA-A Human)
UseEntry vector for gateway systemTagshisAvailable SinceDec. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
TUBG1_pLX307
Plasmid#98376PurposeLentiviral expression of TUBG1DepositorAvailable SinceAug. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 (NT17)
Plasmid#49085PurposeExpresses human NKCC1 with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites. Native hNKCC1 amino acid sequenceDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutation262 silent mutations from native hNKCC1PromoterCMVAvailable SinceNov. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pODN-mNG-ANLN
Plasmid#183834PurposeRepair template for the N-terminal tagging of anillin with mNeonGreen in human cells using CRISPR/Cas9.DepositorInsertANLN homology arms with mNeonGreen-linker (ANLN Human)
UseCRISPR; Donor templateTagsmNeonGreen-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_RBM45_WT
Plasmid#82892PurposeGateway Donor vector containing RBM45, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV[Tet]-Puro-TRE3G>mMyod1[NM_010866.2]
Plasmid#184380PurposeThe mouse Myod1 gene is expressed under a doxcycline-inducible TRE3G promoterDepositorInsertMyod1 (Myod1 Mouse)
UseLentiviralAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-eGFP-PC1-3HA
Plasmid#108406PurposeCan be used to generate stable Flp-In cells with tetracycline-inducible human PC1 expression.DepositorAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_SMURF2_WT
Plasmid#82259PurposeGateway Donor vector containing SMURF2 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_RHEB_WT
Plasmid#81257PurposeGateway Donor vector containing RHEB , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
LIMD1_pLX307
Plasmid#98349PurposeLentiviral expression of LIMD1DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_WNT5A_WT
Plasmid#82240PurposeGateway Donor vector containing WNT5A , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_PKIA_WT
Plasmid#82153PurposeGateway Donor vector containing PKIA , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
DDX39B_pLX307
Plasmid#98331PurposeLentiviral expression of DDX39BDepositorInsertDDX39B (DDX39B Human)
UseLentiviralTagsV5ExpressionMammalianMutationS296PPromoterE1FaAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCIG-FGFRdn
Plasmid#80431PurposeExpression of a dominant-negative FGFR1 with a nuclear EGFP reporter in chick embryosDepositorInsertFibroblast growth factor receptor 1 (FGFR1 Chicken)
TagsEGFPExpressionMammalianMutationcontains aa 1–425Promoterbeta-actin promoterAvailable SinceFeb. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGMC00035 (aka pMG0784)
Plasmid#210768PurposeLentiviral vector to express human ADRM1DepositorAvailable SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-BRD4ΔN-miRFP670-Cry2WT
Plasmid#122439PurposeExpresses disordered protein BRD4(462-1362) fused with fluorescent protein miRFP670 and optogenetic protein Cry2WTDepositorInsertBRD4 (BRD4 Human)
UseLentiviralTagsCry2WT and miRFP670ExpressionMammalianMutationDeleted amino acids 1-461PromoterSFFVAvailable SinceApril 10, 2019AvailabilityAcademic Institutions and Nonprofits only