We narrowed to 40,920 results for: gats
-
Plasmid#164903PurposeExpresses a Rac1 FRET sensor RaichuEV-Rac1 which contains a dominant negative mutation Y40C in the Rac1 domain. More useful than T17N mutation due to less harmful to endogenous signaling.DepositorInsertRaichuEV-Rac1 (RAC1 Human)
UseTagsExpressionMammalianMutationY40C mutation in the Rac1 domain whcih make the s…PromoterAvailable sinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
TFORF2012
Plasmid#142308PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertGATAD2A (GATAD2A Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
Flag-MIOS(1-875) in pRK5
Plasmid#184561PurposeCMV-driven expression of an N-terminally Flag-tagged MIOS (core subunit of GATOR2) — native sequence for transient expression in mammalian cells.DepositorInsertMIOS (MIOS Human)
UseTagsFlagExpressionMammalianMutationPromoterCMVAvailable sinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
TFORF2013
Plasmid#142521PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertGATAD2A (GATAD2A Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-mVenus1-155-I152L-GGGS
Plasmid#162613PurposeAllows for transcription of improved control mVenus I152L fluorophore half for injection into zebrafish embryos for BiFC assaysDepositorInsertmVenus
UseTagsExpressionMammalianMutation1-155-I152LPromoterAvailable sinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC18A1
Plasmid#131985PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC18A1 (SLC18A1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 22, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV-GG-hUbC-EBPF2-gRNA-TGFB2
Plasmid#185556PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting TGFB2DepositorInsertTGFB2 gRNAs
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_4
Plasmid#155062PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and three intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and three intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Basic-Fascin-Promoter 402 mutation
Plasmid#89825PurposeFascin promoter for luciferase assayDepositorInsertFascin1 (FSCN1 Human)
UseLuciferaseTagsExpressionMutation-370 Smad binding element mutated from CAGAC to T…PromoterSV40Available sinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_2-Lb
Plasmid#209028PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_2-As
Plasmid#209032PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-mOrange/CALR del52
Plasmid#214768PurposeMammalian expression of human CALR del52DepositorInserthuman CALR del52 (CALR Human)
UseRetroviralTagsExpressionMutationPromoterMSCVAvailable sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-mOrange/CALR ins5
Plasmid#214769PurposeMammalian expression of human CALR ins5DepositorInserthuman CALR ins5 (CALR Human)
UseRetroviralTagsExpressionMutationPromoterMSCVAvailable sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-RBMS3
Plasmid#185557PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting RBMS3DepositorInsertRBMS3 gRNAs
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-ADGRG6
Plasmid#185554PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting ADGRG6DepositorInsertADGRG6 gRNAs
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 ATG3 C264A
Plasmid#129293PurposeGateway entry clone encoding human ATG3 C264A (catalytic inactive)DepositorInsertUbiquitin-like-conjugating enzyme ATG3 (ATG3 Human)
UseGateway entry vector / entry cloneTagsExpressionMutationchanged Cysteine 264 to AlaninePromoterAvailable sinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 ATG3 allKR
Plasmid#129295PurposeGateway entry clone encoding human ATG3 with all 22 lysine residues mutated to arginineDepositorInsertUbiquitin-like-conjugating enzyme ATG3 (ATG3 Human)
UseGateway entry vector / entry cloneTagsExpressionMutationchanged all 22 Lysine residues to ArgininePromoterAvailable sinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
TFORF2236
Plasmid#141982PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertGATA4 (GATA4 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only