We narrowed to 3,621 results for: biorxiv
-
Plasmid#222929PurposePiggyBac transposon plasmid for doxycycline inducible expression of FIGLADepositorInsertFIGLA (FIGLA Human)
ExpressionMammalianAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-HHEX
Plasmid#222928PurposePiggyBac transposon plasmid for doxycycline inducible expression of HHEXDepositorInsertHHEX (HHEX Human)
ExpressionMammalianAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRE3G-PE2-P2A-BFP
Plasmid#231580PurposeExpresses the PE2 prime-editing machinery fused to BFP (PE2-P2A-BFP), under the control of a TRE3G promoter. This promoter is responsive to doxycycline bound to the rtTA proteinDepositorInsertPE2-P2A-BFP
UseLentiviralTagsP2A-BFPExpressionMammalianPromoterTRE3GAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6/TO-shEsr1-CMV-TetR-eGFP
Plasmid#233298PurposeDOX-inducible U6 driven shRNA against mouse Esr1DepositorAvailable SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
M13cp-dg2 hp
Plasmid#218094PurposeHelper plasmid that allows phagemid production upon complementation with a phagemid expressing pIIDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
M13cp-dg1 hp
Plasmid#218093PurposeHelper plasmid that allows phagemid production upon complementation with a phagemid expressing pIDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-ALFA
Plasmid#242764PurposeAAV transfer plasmid expressing eGFP-ALFA under a CAG promoter.DepositorInsertEGFP
UseAAVTagsALFAPromoterCAGAvailable SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBK2044-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2
Plasmid#223164Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1314-AAV-EFSNC-dSaCas9-KRAB-MECP2
Plasmid#223159PurposeExpression of KRAB and truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBOB-CAG-SARS-CoV2-Spike D614G-HA
Plasmid#158761Purpose3rd Generation lentiviral vector expressing the codon optimized SARS-CoV2 Spike Glycoprotein D614G high infectivity mutant with a C-terminal HA tag generated by Junko Ogawa & Gerald M PaoDepositorInsertSARS-CoV2 Spike Glycoprotein (S SARS-CoV2 hCoV19_USA EPI_ISL_414366 (GISAID))
UseLentiviralTagsHAExpressionMammalianMutationSpike D614GPromoterCAGAvailable SinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-SpCas9D10A nickase
Plasmid#216737PurposeExpresses SpCas9-D10A nickase from a CMVd1 promoter. For AAV packaging. Derived from pAAV-CMV-SpCas9 (Addgene #113034)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRExpressionMammalianMutationD10APromoterCMVd1Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-EF1a-E1MLS-2xFLAG-LigD-IRES-tdTomato
Plasmid#234951PurposeHuman codon optimized LigD (Mycobacterium) with N-terminal E1 MLS expressing plasmidDepositorInsertHuman codon optimized LigD with N-terminal mitochondrial localization signal of pyruvate dehydrogenase E1 subunit
UseLentiviralTagsFLAGExpressionMammalianPromoterEF1AAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eGFP-HA
Plasmid#242768PurposeAAV transfer plasmid expressing eGFP-HA under a CAG promoter.DepositorInsertEGFP
UseAAVTagsHAPromoterCAGAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBK1304-AAV-EFSNC-dCjCas9-KRAB-MECP2
Plasmid#223149PurposeExpression of KRAB and truncated MECP2 with dCjCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHA TST 3C SMO EABR
Plasmid#234989PurposeFor production of Extracellular Vesicles (EVs), with the receptor Smoothened (Smo), Twin-Strep-tag (TST), and an HA tag at its N-terminus on their surfaceDepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHA StreptagII 3C NIS EABR
Plasmid#234988PurposeFor production of Extracellular Vesicles (EVs), with a Strep-tag II labeled Sodium-iodide symporter (NIS), and an HA epitope at its N-terminus on their surfaceDepositorAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-EF1a-E1MLS-2xMyc-Ku-IRES-Hygro
Plasmid#234950PurposeHuman codon optimized Ku (Mycobacterium) with N-terminal E1 MLS expressing plasmidDepositorInserthuman codon optimized Ku with N-terminal mitochondrial localization signal of pyruvate dehydrogenase E1 subunit
UseLentiviralTagsMycExpressionMammalianPromoterEF1aAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgCTG-CMV-GFP
Plasmid#216734PurposeAAV plasmid containing sgCTG (target sequence: (CUG)6) driven by a U6 promoter and eGFP under the control of the CMV promoter. Used for in vivo experiments.DepositorArticleInsertsgCTG
UseAAV and CRISPRExpressionMammalianPromoterU6 and CMVAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-SpCas9D10A nickase
Plasmid#216736PurposeExpresses SpCas9-D10A nickase from a nEF promoter. For AAV packaging. Derived from pAAV-nEF-SpCas9 (Addgene #87115)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRExpressionMammalianMutationD10APromoterEF-1-alpha coreAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only