We narrowed to 4,923 results for: lenti sgrna
-
Plasmid#179724PurposeU6-driven SYT7 gRNA and HaloTag lentiviral vector for CRISPR/HITIDepositorInsertsgRNA and HaloTag
UseLentiviralAvailabilityAcademic Institutions and Nonprofits only -
pLV sgRNA-Notch1 #1 GFP
Plasmid#106950PurposeLentivirus encoding sgRNA targeting murine Notch1. Includes GFP marker.DepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA-CBh-eGFP
Plasmid#206885Purposecloning backbone for sgRNA using OptScf2DepositorTypeEmpty backbonePromoterU6Available SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV sgRNA-Notch1 #2 GFP
Plasmid#106951PurposeLentivirus encoding sgRNA targeting murine Notch1. sgRNA is less optimal. Includes GFP marker.DepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV sgRNA-Notch1 #3 GFP
Plasmid#106952PurposeLentivirus encoding sgRNA targeting murine Notch1. sgRNA is less optimal. Includes GFP marker.DepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGH020_sgRNA_G418-GFP
Plasmid#85405Purposehu6 driven sgRNA vector with G418 and GFP selectable markersDepositorInsertG418 resistance and GFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
double_sgRNA targeting e3 and e7
Plasmid#190689PurposesgRNAs targeting enhancer 3 and 7 of MYC separatelyDepositorInsertsgRNAs targeting enhancer 3 and 7 of MYC separately
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
double_sgRNA targeting e1 and e4
Plasmid#190688PurposesgRNAs targeting enhancer 1 and 4 of MYC separatelyDepositorInsertsgRNAs targeting enhancer 1 and 4 of MYC separately
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1373_mU6_sgRNA targeting e1
Plasmid#190684PurposesgRNA targeting enhancer 1 of MYCDepositorInsertsgRNA targeting enhancer 1 of MYC
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianPromotermouse U6 promoterAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ5004_hU6_sgRNA targeting e7
Plasmid#190687PurposesgRNA targeting enhancer 7 of MYCDepositorInsertsgRNA targeting enhancer 7 of MYC
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianPromoterHuman U6 promoterAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ5004_hU6_sgRNA targeting e4
Plasmid#190686PurposesgRNA targeting enhancer 4 of MYCDepositorInsertsgRNA targeting enhancer 4 of MYC
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianPromoterHuman U6 promoterAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1373_mU6_sgRNA targeting e3
Plasmid#190685PurposesgRNA targeting enhancer 3 of MYCDepositorInsertsgRNA targeting enhancer 3 of MYC
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianPromotermouse U6 promoterAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO-sgRNA-puro
Plasmid#104321Purpose3rd generation lentiviral plasmid for inducible expression of sgRNA; derived from tet-pLKO-puro; puromycin selection. See manual for detailed protocols.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterH1/TOAvailable SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC1-A_sgBC1-C
Plasmid#154196PurposeLentiviral expression plasmid encoding two sgRNAs for targeting of the CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC1-A, sgRNA-BC1-C
UseLentiviral; Catch barcode activationExpressionMammalianPromoterhU6 and mU6Available SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC2-A_sgBC2-C
Plasmid#154197PurposeLentiviral expression plasmid encoding two sgRNAs without a target. These can be used as a off-target control for CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC2-A, sgRNA-BC2-C
UseLentiviral; Catch barcode activationExpressionMammalianPromoterhU6 and mU6Available SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6-NT sgRNA; EF1a-dCas9-KRAB-GFP
Plasmid#194284PurposeEF1a-dCas9-KRAB-GFP with nontarget sgRNADepositorInsertdCas9-KRAB-GFP
UseCRISPR and LentiviralTagsGFPPromoterEF1aAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
LV-U6-sgRNAfiller-PGK-Cre-EFS-mScarletSIIN
Plasmid#172436PurposeLentivirus, expresses Cre recombinase and mScarlet-SIINFEKL, with sgRNA cloning siteDepositorInsertsCre
mScarlet-SIINFEKL(OVA257-264)+Ova 323-339
UseCRISPR and LentiviralAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
hPLD3-sgRNA-Cas9_mcherry
Plasmid#199342Purposeencodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX-sgRNA-BfuAI-2k
Plasmid#112915PurposeEmpty sgRNA expression plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceSept. 21, 2018AvailabilityAcademic Institutions and Nonprofits only