We narrowed to 7,218 results for: aav
-
Plasmid#183802PurposeAAV vector to express nuclear localized dsRed-Express from CaMKIIa promoterDepositorInsertdsRed-Express
UseAAVTagsNLSAvailable SinceMarch 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-miRFP670-2-P2A-GFP
Plasmid#197170PurposeExpresses the protein of miRFP670-2-P2A-GFP in mammalian cellsDepositorInsertmiRFP670-2-P2A-GFP
UseAAVAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-iRFP670-P2A-GFP
Plasmid#197169PurposeExpresses the protein of iRFP670-P2A-GFP in mammalian cellsDepositorInsertiRFP670-P2A-GFP
UseAAVAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-mCardinal-P2A-GFP
Plasmid#197167PurposeExpresses the protein of mCardinal-P2A-GFP in mammalian cellsDepositorInsertmCardinal-P2A-GFP
UseAAVAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-iRFP713-P2A-GFP
Plasmid#197166PurposeExpresses the protein of iRFP713-P2A-GFP in mammalian cellsDepositorInsertiRFP713-P2A-GFP
UseAAVAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-E2-Crimson-P2A-GFP
Plasmid#197162PurposeExpresses the protein of E2-Crimson-P2A-GFP in mammalian cellsDepositorInsertE2-Crimson-P2A-GFP
UseAAVAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-emiRFP703-P2A-GFP
Plasmid#197158PurposeExpresses the protein of emiRFP703-P2A-GFP in mammalian cellsDepositorInsertemiRFP703-P2A-GFP
UseAAVAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-IFP2-P2A-GFP
Plasmid#197161PurposeExpresses the protein of IFP2-P2A-GFP in mammalian cellsDepositorInsertIFP2-P2A-GFP
UseAAVAvailable SinceMarch 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-mRhubarb720-P2A-GFP
Plasmid#197159PurposeExpresses the protein of mRhubarb720-P2A-GFP in mammalian cellsDepositorInsertmRhubarb720-P2A-GFP
UseAAVAvailable SinceMarch 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-BDFP1.6-P2A-GFP
Plasmid#197154PurposeExpresses the protein of BDFP1.6-P2A-GFP in mammalian cellsDepositorInsertBDFP1.6-P2A-GFP
UseAAVAvailable SinceMarch 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-mRhubarb719-P2A-GFP
Plasmid#197152PurposeExpresses the protein of mRhubarb719-P2A-GFP in mammalian cellsDepositorInsertmRhubarb719-P2A-GFP
UseAAVAvailable SinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV/CBA::EGFP-P2A-myc-C3
Plasmid#129478PurposeAAV2 transfer plasmid for myc-tagged C3 with EGFP under control of the CBA promoterDepositorInsertMyc-tagged (N-terminus) exoenzyme C3 from C. botulinum, P2A, EGFP
UseAAVExpressionMammalianPromoterCBAAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV/CBA::EGFP-P2A-tC3
Plasmid#129476PurposeAAV2 transfer plasmid for truncated C3 with EGFP under control of the CBA promoterDepositorInserttruncated (AA173-201) exoenzyme C3 from C. botulinum, P2A, EGFP
UseAAVExpressionMammalianPromoterCBAAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4a
Plasmid#194973PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4a) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4d
Plasmid#194975PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4d) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mEGFP-Gphn_P1
Plasmid#194978PurposeAAV vector to drive the Flp-dependent expression of mEGFP (L221K) -Gphn (isoform P1) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_P1
Plasmid#194972PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform P1) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4c
Plasmid#194974PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4c) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOttc1494 - pAAV CaMKII SERCaMP-No Tag
Plasmid#192601PurposeAn AAV packaging vector that expresses SERCaMP under control of the CaMKII promoter.DepositorInsertSERCaMP
UseAAVPromoterCaMKIIAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only