We narrowed to 2,901 results for: aen
-
Plasmid#132523PurposemNG^SEC^3xFlag vector with ccdB markers for cloning homology armsDepositorInsertmNG-C1^SEC^3xFlag
UseCRISPR and Cre/LoxTags3xFlag and C. elegans codon-optimized mNGExpressionWormAvailable SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDD282
Plasmid#66823PurposeGFP^SEC^3xFlag vector with ccdB markers for cloning homology armsDepositorInsertGFP-C1^SEC^3xFlag
UseCRISPR and Cre/LoxTags3xFlag and C. elegans codon-optimized GFPExpressionWormAvailable SinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHW522 (Prab-3::cGAL-C::let-858 3'UTR)
Plasmid#107130PurposecGAL-C driver under the control of C. elegans rab-3 promoterDepositorInsertNLS::gp41-1-C-intein::cGAL(AD)
ExpressionWormPromoterC. elegans rab-3 promoterAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMS79 (eft-3p::Cas9 + sgRNA)
Plasmid#154839PurposeCas9 + sgRNA plasmid that is targeted to the synthetic guide sequence GGACAGTCCTGCCGAGGTGGDepositorInsertsgRNA
UseCRISPRExpressionWormAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
Pflp-18::NGL-1::spGFP11
Plasmid#65828PurposeFor trans-synaptic labelingDepositorAvailable SinceNov. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-TaGu-WT-3xF-ORF
Plasmid#238487PurposeFor production of C-term flag-tagged TaGu R2 ORF mRNA for mRNA transfection in PRINTDepositorInsertR2 retroelement mRNA
UseIvt templateTags3x-FlagAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSicoR
Plasmid#11579PurposeCre-regulated lentiviral shRNA vector. Cre addition causes both EGFP and shRNA to be recombined out of the construct, turning OFF shRNA expression.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCre/Lox, Lentiviral, and RNAiExpressionMammalianAvailable SinceAug. 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCpf1b-sp
Plasmid#122188PurposeBacterial genome editing plasmid with spectinomycin resistance marker and using sacB as a counter-selection markerDepositorTypeEmpty backboneUseCRISPRExpressionBacterialAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only