We narrowed to 3,402 results for: aaas
-
Plasmid#177764PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_2
Plasmid#155074PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_4
Plasmid#155076PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_4
Plasmid#155072PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_4
Plasmid#155062PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and three intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and three intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_5
Plasmid#155063PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_3
Plasmid#155061PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_2
Plasmid#155060PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and an intergenic site & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-SNCA-A53T
Plasmid#181738PurposeTransiently expressing a pegRNA to introduce SNCA-A53T mutation in human cellsDepositorInsertPrime editing pegRNA for SNCA-A53T (SNCA Synthetic)
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-SNCA-A30P
Plasmid#180016PurposeTransiently expressing a pegRNA to introduce SNCA-A30P mutation in human cellsDepositorInsertPrime editing pegRNA for SNCA-A30P (SNCA Synthetic)
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV Syn Barcode14
Plasmid#226188PurposeExpression mappingDepositorInsertSyn Barcode14
UseAAVAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV Syn Barcode18
Plasmid#226191PurposeExpression mappingDepositorInsertSyn Barcode18
UseAAVAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
-
pCfb13206
Plasmid#219881PurposeThe base plasmid of TUNEYALI for TF16DepositorInsertContains gRNA targeting TF16 (YALI1_B11759g) and homologous arm matching TF16
ExpressionYeastAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
CBFRE (mt) EGFP
Plasmid#26870DepositorInsertCBFRE
UseAdenoviralTagsEGFPExpressionMammalianMutationThe mutated CBF1 binding site: GATCTGGTGTAAA CAC…Available SinceNov. 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
pTaU6-esgRNA
Plasmid#115630Purposeexpression esgRNA in wheat protoplastsDepositorInsertTaU6p-esgRNA
UseCRISPRAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOsU3-esgRNA
Plasmid#115629Purposeexpression esgRNA in rice protoplastsDepositorInsertOsU3p-esgRNA
UseCRISPRAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pLH-nmsgRNA1.1
Plasmid#64115PurposeVector for expression of Nm sgRNA1.1 in mammalian cellsDepositorInsertNm sgRNA1.1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCR3.1-OPNc M3
Plasmid#106323PurposeMammalian expression of mutant osteopontinDepositorAvailable SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC57-CmYLCV
Plasmid#205245PurposeFor plant prime editing in wheat plants or monocotyledons protoplastsDepositorInsertCmYLCV-csy4_binding_site-esgRNA-tevopreQ1-csy4_binding_site
UseCRISPRExpressionPlantPromoterCmYLCVAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLH-spsgRNA2
Plasmid#64114PurposeVector for expression of Sp sgRNA2 in mammalian cellsDepositorInsertSp sgRNA2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCR8-attL3-pegRNA-attL2
Plasmid#213052PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL3 and attL2DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8-attL1-pegRNA-attR3
Plasmid#213051PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL1 and attR3DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8-attL5-pegRNA-attR3
Plasmid#213054PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL5 and attR3DepositorInsertsgRNA
ExpressionBacterialAvailable SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8-attR4-pegRNA-attR3
Plasmid#213056PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attR4 and attR3DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8-attL5-pegRNA-attL4
Plasmid#213055PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL5 and attL4DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8-attL1-pegRNA-attR5
Plasmid#213053PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL1 and attR5DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHK352.3
Plasmid#235473PurposeMessage phagemid carrying sgRNA3 (prom. J23110, backbone RSF1030)DepositorInsertsgRNA3
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AasgRNA
Plasmid#121954PurposeMammalian expression, Genome editing, gRNA scaffoldDepositorInsertAaCas12b single chimeric gRNA
ExpressionMammalianAvailable SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
YN2_1_LT84_RPL13A
Plasmid#177712PurposeExpresses Cas9 and sgRNA cassette for targeting RPL13A in yeast Saccharomyces cerevisiaeDepositorInsertCas9
UseCRISPRExpressionYeastAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHK302.6
Plasmid#235471PurposeMessage phagemid carrying sgRNA6 (prom. J23110, backbone pBR322)DepositorInsertsgRNA6
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK052.3
Plasmid#235472PurposeMessage phagemid carrying sgRNA3 (prom. J23119, backbone RSF1030)DepositorInsertsgRNA3
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.1
Plasmid#235460PurposeMessage phagemid carrying sgRNA1 (prom. J23119, backbone pBR322)DepositorInsertsgRNA1
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.2
Plasmid#235461PurposeMessage phagemid carrying sgRNA2 (prom. J23119, backbone pBR322)DepositorInsertsgRNA2
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHK002.3
Plasmid#235462PurposeMessage phagemid carrying sgRNA3 (prom. J23119, backbone pBR322)DepositorInsertsgRNA3
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only