We narrowed to 5,975 results for: crispr cas9 expression plasmids
-
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330a dCas9-LSD1
Plasmid#92362PurposeModified CAG promoter-containing vector for ubiquitous expression of catalytically inactive Cas9 fused to LSD1. For targeted enhancer demethylation in chicken embryos.DepositorInsertdCas9-LSD1
UseCRISPRExpressionMammalianPromoterCAGAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti_dCas9-2xAM
Plasmid#92220PurposeLentiviral plasmid expressing dCas9-2xAM and gRNA cloned in Bbs I sitesDepositorInsertsSp-dCas9-2xAM tag
gRNA to be inserted into Bbs I sites
UseCRISPR and LentiviralTags2xAM tagExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterCBh and U6Available SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
SP6-hCas9-Ce-mRNA
Plasmid#47911PurposeIn vitro transcription of a mRNA encoding humanized Cas9 nuclease, with 3' UTRs suitable for germline expression in C. elegans, for doing CRISPR-Cas by RNA injection. Uses SP6 RNA polymerase.DepositorInserthCas9 with C. elegans 5' and 3' UTRs
UseCRISPRPromoterSP6Available SinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
1137B=Hsp70Bb-Cas9
Plasmid#153284PurposeThe attB plasmid harboring the Hsp70Bb-Cas9-T2A-eGFP-p10 and a mini-white marker.DepositorInsertpHsp70Bb-SpCas9-T2A-eGFP-p10 (cas9 Synthetic)
UseCRISPRTagseGFPExpressionInsectPromoterDmel Hsp70BbAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
Native promoter dCas9
Plasmid#113656PurposedCas9 expression unit plasmid. The dCas9 expression unit plasmids contain connector ConL1, ConRE, and one dCas9 transcriptional unit.DepositorInsertNative promoter and dCas9
UseCRISPRExpressionBacterialPromoterS. pyogenes Cas9 native promoterAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-dCas9GFP-shP53
Plasmid#102906PurposeEBNA episome plasmid for CAG promoter constitutive expression of dCas9-GFP. Includes p53 shRNA expression cassette.DepositorInsertdCas9GFP-shP53
UseCRISPRExpressionMammalianMutationD10A, H840APromoterCAGAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-Tet1-CD
Plasmid#83340PurposeTo introduce dCas9-fused Tet1-CD and sgRNA2.0 systemDepositorInsertdCas9-Tet1-CD and sgRNA scaffold with 2xMS2 binding sites
UseCRISPRExpressionMammalianMutationD10A, H840APromoterU6, CBHAvailable SinceOct. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR
Plasmid#118154PurposeCatalytically inactive Cas9 from S. pyogenes with P2A-BlastR under the EF1a core promoter, and cloning backbone for sgRNA. Contains BsmBI sites for insertion of spacer sequences.DepositorInsertKRAB-dCas9-P2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationSee depositor comments belowPromoterEF1a core and U6Available SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP314-pAAV-U6SaCas9gRNA(SapI)-CMV-SaCas9-DIO-pA
Plasmid#113691PurposeU6 driven SaCas9 gRNA expression cassette followed by a CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorInsertSaCas9
UseAAV, CRISPR, and Cre/LoxTagsNLSPromoterCytomegalo Virus(CMV)Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP315-pAAV-U6SaCas9gRNA(CREB)-CMV-SaCas9-DIO-pA
Plasmid#113692PurposeU6 SaCas9 gRNA expression cassette containing a gRNA targeting the CREB gene, followed by a CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorUseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsNLSPromoterCytomegalo Virus(CMV)Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-SpCas9
Plasmid#85450PurposeExpress SpCas9 in mammalian cellsDepositorHas ServiceAAV8InsertpRSV
UseAAVPromoterpRSVAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-TO-dCas9-P2A-HSA
Plasmid#121936PurposeCRISPR-Sirius plasmidDepositorInsertdCas9-P2A-HSA
UseCRISPR and LentiviralTagsHSAExpressionMammalianPromoterCMV-TOAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX459V2.0-eSpCas9(1.1)+K855A
Plasmid#108298PurposepX459 V2.0 (Plasmid #62988) with the K848A, K855A, K1003A, and R1060A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459V2.0-eSpCas9(1.1)+K810A
Plasmid#108297PurposepX459 V2.0 (Plasmid #62988) with the K810A, K848A, K1003A, and R1060A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-enCas9-PolI5M
Plasmid#113078PurposeExpresses enCas9 fused to PolI5M in E. coli. contains a BsmbI-flanked GFP cassette for sgRNA cloning.DepositorInsertenCas9-PolI5M
UseCRISPRExpressionBacterialAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N
Plasmid#80930PurposeExpresses Cas9N in mammalian cells.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CASI-Cas9C
Plasmid#80932PurposeExpresses Cas9C in mammalian cells; derived from pZac2.1 with CASI promoter.DepositorInsertCas9C
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Hyg
Plasmid#232095PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Nat
Plasmid#232094PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only