We narrowed to 4,111 results for: plasmid lenti crispr
-
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_1
Plasmid#155081PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_4
Plasmid#155084PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_2
Plasmid#155082PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lv EF1a dCas9-HA 2A Blast
Plasmid#102812PurposeLentiviral plasmid from FIRE-Cas9 system to express dCas9-HA fusion proteinDepositorInsertdCas9-HA
UseCRISPR and LentiviralExpressionMammalianMutationD10A and N863A (dCas9)PromoterEF1aAvailable SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
EF1α-scFv-p65-HSF1-T2A-EGFP-WPRE-PolyA
Plasmid#107311PurposeEncoding scFv-p65-HSF1 driven by EF1α promoterDepositorInsertEF1α-scFv-p65-HSF1-T2A-EGFP-WPRE-PolyA
UseLentiviralExpressionMammalianAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRH051
Plasmid#171625Purpose2nd generation lentiviral transfer plasmid encoding a U6 promoter expressing a spyCas9 sgRNA (no spacer, BsmBI cutsites) and an EF1-a promoter expressing mNeonGreenDepositorInsertsspyCas9 sgRNA-BsmBI-Destination
mNeon
UseCRISPR and LentiviralExpressionMammalianPromoterEF1-a and U6Available SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lv EF1a MS2-Fkbp2x 2A Hygro
Plasmid#102807PurposeLentiviral plasmid from FIRE-Cas9 system to express MS2-Fkbp2x fusion proteinDepositorInsertMS2-Fkbp2x
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry GFP
Plasmid#78535PurposeControl plasmid (paired gRNAs against GFP)DepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 (for expressing sgRNA) and U6 promoterAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LRG2.1-TagBFP2
Plasmid#124773PurposeLentiviral plasmid to co-express a guide RNA and TagBFP2DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-multi-v2-Puro-BsmBI_entry (pRW1484)
Plasmid#225752PurposeEntry vector to clone sgRNA(s) into the CROPseq-multi-v2 construct with Puromycin resistance; v2 is compatible with T7 in vitro transcription detectionDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-hU6-ZNF865-hUbC-dCas9-KRAB-eGFP
Plasmid#241308Purpose3rd gen lenti vector encoding dCas9 (s. Pyogenes) fused with the KRAB and a 2A eGFP fluorescence marker. Includes guide for suppression of the ZNF865 geneDepositorInsertZNF865 sgRNA (ZNF865 Human)
UseLentiviralAvailable SinceDec. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-sgCDKN1B#2 BFP
Plasmid#60905PurposeA lentiviral plasmid that encodes both a sgRNA targeting CDKN1B and BFPDepositorInsertBFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLX-sgRNA-BfuAI-2k
Plasmid#112915PurposeEmpty sgRNA expression plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceSept. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-mCherry
Plasmid#217005Purposelentiviral plasmid for gRNA cloning with selectable mCherry expressionDepositorTypeEmpty backboneUseLentiviralAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_4
Plasmid#155062PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and three intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and three intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only