We narrowed to 363 results for: tp53
-
Plasmid#214447PurposeExpresses eSpCas9 and gRNA targeting Olônne-18 GSHDepositorInserteSpCas9-P2A-mRuby2-P2A-tp53dn
UseCRISPRExpressionMammalianPromoterEF1aAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-eYFP-FKBP-MAD1-WT
Plasmid#114037PurposeChemical induction of MAD1 localisation to a specific site in the cell (by rapamycin & FRB)DepositorAvailable SinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
Oct4deltaPE-53BP1mCherry
Plasmid#141122PurposeConstruct used to generate a transgenic mouse strain with expression of 53BP1-mCherry in embryonic germ cellsDepositorAvailable SinceJuly 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-eGFP-53BP1
Plasmid#60813Purposemammalian expression vectorDepositorAvailable SinceDec. 9, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-eYFP-FKBP-MAD1-AA
Plasmid#114038PurposeChemical induction of MAD1 localisation to a specific site in the cell (by rapamycin & FRB)DepositorInsertHuman MAD1 (MAD1L1 Human)
TagseYFP-FKBP12ExpressionMammalianMutationMAD2 binding deficient MAD1 K541A/L543APromoterCMVAvailable SinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUW-TetO-LITAF
Plasmid#178444Purposedoxycycline-inducible expression of Human LITAF in mammalian cellsDepositorAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPN130
Plasmid#91637PurposeExpress sgRNA targeting human MAD1L1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN131
Plasmid#91638PurposeExpress sgRNA targeting human MAD1L1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR-53BP1 1-1972 WT
Plasmid#53446PurposeRecombinational donor/master vectorDepositorInsert53BP1 (TP53BP1 Human)
UseGatewayMutationsiRNA resistant and mutations A128V, T720A, A1347…Available SinceApril 10, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSpCas9(BB)-T2A-Puro_h53BP1_gRNA_D
Plasmid#110302PurposeExpresssion of Cas9-T2A-puromycin resistant gene and a gRNA targeting exon 10 of human 53BP1DepositorInsertp53-binding protein 1 (TP53BP1 Human)
ExpressionMammalianAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-FRT/T0-eGFPnls-53BP1 1220-1631 WT
Plasmid#60814Purposemammalian expression vectorDepositorAvailable SinceApril 10, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
TFORF2243
Plasmid#141987PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX458M-53BP1-DN1S
Plasmid#131045PurposePlasmid encoding Cas9-53BP1-DN1S fusion with BbsI restriction sites for insertion of guide RNA sequence.DepositorInsertSpCas9-53BP1-DN1S (TP53BP1 Human)
UseCRISPRTagsGFP and SpCas9ExpressionMammalianMutationOnly expressing residues 1231-1644 of complete 53…PromoterCBHAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/T0-Flag-53BP1
Plasmid#52507Purposemammalian expression vector of 53BP1DepositorInsert53BP1 (TP53BP1 Human)
TagsFlagExpressionMammalianMutationV128A and siRNA resistant sequence: ACGCGCTGACGAC…PromoterCMV/TOAvailable SinceMarch 26, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSpCas9(BB)-2A-Neo_h53BP1_gRNA_D
Plasmid#110300PurposeExpresssion of Cas9-T2A-neomycin resistant gene and a gRNA targeting exon 10 of human 53BP1DepositorInsertp53-binding protein 1 (TP53BP1 Human)
ExpressionMammalianAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
TFORF3204
Plasmid#144680PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR-53BP1 1-1972 28A
Plasmid#53447PurposeRecombinational donor/master vectorDepositorInsert53BP1 (TP53BP1 Human)
UseGatewayMutationI914T mutation; All 28 SQ/TQ motifs in N-term of …Available SinceDec. 10, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMX-53BP1(1-1710) 3LA
Plasmid#185698PurposeMammalian Expression, Retroviral vector that encodes a 3LA mutant of 53BP1 that disrupts three RIF1-binding motifs and abolishes the 53BP1-dependent recruitment of RIF1 to DNA double-strand breaks.DepositorInsert53BP1(1-1710) 3LA (TP53BP1 Human)
UseRetroviralTagsFlag tag, HA tag, and tetracysteine tagExpressionMammalianMutationL175A, L517A, and L693APromoterSV40Available SinceJuly 7, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMX-53BP1(1-1710) 3LA7A
Plasmid#185707PurposeMammalian Expression, Retroviral vector that encodes 7A and 3LA mutant of 53BP1. Prevents shieldin and RIF1 recruitment to sites of double-strand breaks and disrupts 53BP1 activity.DepositorInsert53BP1(1-1710) 3LA7A (TP53BP1 Human)
UseRetroviralTagsFlag tag, HA tag, and tetracysteine tagExpressionMammalianMutationT302A, S452A, S523A, S543A, S625A, S784A, and S89…PromoterSV40Available SinceJuly 1, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits