We narrowed to 5,224 results for: Mos
-
Plasmid#232118PurposeFor bacterial expression of Flag-tagged E. coli LplA.DepositorInsertlplA (lplA Escherichia coli (strain K12))
TagsFlagExpressionBacterialPromoterT7 PromoterAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
YA1629: pAAV_CAG-FLEX-paQuasAr3-s
Plasmid#107703Purposein vivo voltage imagingDepositorInsertpaQuasAr3
UseAAVExpressionMammalianAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
YA1627: pAAV_hSyn-Dio-paQuasAr3-s-P2A-CheRiff-s
Plasmid#107704Purposein vivo voltage imagingDepositorInsertpaQuasAr3-P2A-CheRiff
UseAAVExpressionMammalianAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
HiBiT-FZD9
Plasmid#195847PurposeExpresses human FZD9 with an N-terminal HiBiT; contains P199R; I448V; S524N; R556HDepositorAvailable SinceMarch 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
CFAP410_pcDNA6.2/EmGFP-Bsd
Plasmid#176948PurposeMammalian expression vector encoding CFAP410 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
Polymerase expression - pCMV-ePhi29 (LM2802)
Plasmid#208967PurposeUnfused ePhi29 DNA polymerase (-exo), expressed from CMV or T7 promoters.DepositorInsertePhi29-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationePhi29(-exo)(D169A;M8R/V51A/M97T/G197D/E221K/Q497…PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-NUDT5
Plasmid#219954PurposeFor gateway cloning of NUDT5DepositorInsertNUDT5 (NUDT5 Human)
Available SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pME-3xNLS-(G2SG2)2-Cre (JDW 1149)
Plasmid#224514PurposeA Gateway compatible middle entry clone containing a 3x nuclear localization signal followed by a multiple cloning site and a flexible linker fused to CreDepositorInsert3xNLS-(G2SG2)2-Cre
UseCre/LoxAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-eYFP-FKBP-MAD1-AA
Plasmid#114038PurposeChemical induction of MAD1 localisation to a specific site in the cell (by rapamycin & FRB)DepositorInsertHuman MAD1 (MAD1L1 Human)
TagseYFP-FKBP12ExpressionMammalianMutationMAD2 binding deficient MAD1 K541A/L543APromoterCMVAvailable SinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pD2sE_SC10
Plasmid#219716PurposeDV2 stable E dimer with fusion loop mutationDepositorInsertDV2 sE SC10
Tags8xHis and human serum albumin (HSA)ExpressionMammalianMutationG106D, A259W, T262R, F279W, T280PAvailable SinceAug. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
H14-MBP-SUMO-Cys-Linker-BAF_G47E
Plasmid#101779PurposeExpresses His-MBP-tagged mutant BAF (G47E) in E.coli (SUMO-cleavable)DepositorInsertBAF (BANF1) (BANF1 Human)
TagsHis14-MBP-SUMOExpressionBacterialMutationG47E mutationPromoterT5Available SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Frt-hspB8
Plasmid#63099PurposeExpression of HSPB8 (small HSP) in mammalian cellsDepositorAvailable SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOD2087-trnDEG
Plasmid#89369PurposeMosSCI targeting vector expressing a fusion between a GFP nanobody and an ubiquitin ligase adaptor ZIF-1 to degrade GFP tagged proteins. Expression is controlled by Pmec-18 (touch neuron specific).DepositorInsertvhhGFP4-ZIF-1 (zif-1 Synthetic, Nematode)
UseTargeting vector for mos1 transposon mediated sin…TagsvhhGFP4 (GFP nanobody)PromoterPmec-18Available SinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
Recruited polymerase expression - pCMV-T7-EcKlenow-CC(N5) (LM2696)
Plasmid#208969PurposeRecruited EcKlenow DNA polymerase (-exo) with a C-terminal N5 coiled coil (CC) domain, expressed from CMV or T7 promoters.DepositorInsertEcKlenow-BPNLS-CC(N5)
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationEcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
KCNE2_pcDNA6.2/EmGFP-Bsd
Plasmid#176980PurposeMammalian expression vector encoding KCNE2 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
p4949 pLPCX-His-Xpress NLS hBrd4 CTD
Plasmid#14459DepositorInsertBrd4 CTD (BRD4 Human)
UseRetroviralTagsSV40 NLSExpressionMammalianMutationamino acids 1047-1362 of Brd4 (the CTD). Function…Available SinceMarch 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-ccdB-mRuby3
Plasmid#166139PurposeGateway destination vector for generation of Galactose-inductibe, C-terminal mRuby3-tagged proteins in yeast. Contains a CEN/ARS element for low copy number when in yeast.DepositorTypeEmpty backboneTagsmRuby3ExpressionYeastAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-tetpA-hNEUROG2-iRPT
Plasmid#140764PurposeExpresses iRFP713, PuroR and rtTAM2 in mammalian cells, with TRE-hNEUROG2DepositorInsertsExpressionMammalianAvailable SinceJuly 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4-Tet-on-vsv-CenpB 1-166-dCEN- Incenp-GFP
Plasmid#108484Purposeinducible expression of vsv-CenpB-1-166-dCEN-INCENP-EGFPDepositorInsertCenpB-dCEN-INCENP (INCENP Human)
TagsEGFP and VSVExpressionMammalianMutationCEN box replaced by CenpB 1-166PromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only