We narrowed to 57,746 results for: plasmid
-
Plasmid#119945PurposeExpresses SunTag-Renilla mRNA reporter in mammalian cells; note plasmid contains 24xGCN4 repeatsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRenilla luciferase
Tags24xGCN4 repeats (SunTag), 24xMS2v5 stem loops in …ExpressionBacterial and MammalianPromoterTetCMVAvailable sinceMarch 6, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGDP1 NDM-1
Plasmid#112883PurposeThis plasmid is part of the Minimal Antibiotic Resistance Platform (ARP) Kit (Addgene #1000000143). Low copy-number plasmid that constitutively expresses genes using the Pbla promoter.DepositorAvailable sinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMRE142
Plasmid#118494Purposebroad-host range plasmid to constitutively express fluorescent protein genes in bacteriaDepositorInsertsGFP2
ExpressionBacterialAvailable sinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIVM_26
Plasmid#204501PurposeExpression of EloB (1-104) and EloC (17-112) for production of VCB complexes in conjunction with plasmid pIVM_02 (VHL 54-213)DepositorExpressionBacterialMutation0PromoterAmpRAvailable sinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONRp5-p2 SspB-mCherry-CShroom3
Plasmid#170977PurposeC-terminal component of OptoShroom3 optogenetic tool. Translocates to apical junctions to induce constriction upon blue light illumination if coexpressed with GFP-NShroom3-iLID. pDONRp5-p2 plasmid.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCShroom3 (Shroom3 Mouse)
UseGateway CloningTagsSspB and mCherryMutationIsoform X2, deleted aminoacids 1 - 1388Available sinceJuly 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLX301-ZIM3-KRAB-PYL1
Plasmid#154761PurposeExpresses ZIM3 KRAB domain fused to PYL1DepositorInsertZIM3 (ZIM3 Human)
UseLentiviralExpressionMammalianMutationIncludes ZIM3 aa 1-100PromoterCMVAvailable sinceOct. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTol1-UAS:ChrimsonR-tdTomato
Plasmid#124231PurposeZebrafish Tol1 construct for UAS-mediated expression of the optogenetic opsin ChrimsonR fused to the red fluorescent protein tdTomatoDepositorInsertChrimsonR-tdTomato
UseZebrafish expressionTagstdTomatoPromoter14xUAS-E1bAvailable sinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAR-Ec611
Plasmid#130872PurposeA nuclear plasmid encoding an error-prone mutant TP-DNAP1 (I777K, L900S) for OrthoRepDepositorInsertTP-DNAP1
ExpressionYeastMutationI777K, L900SAvailable sinceAug. 21, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pinducer 20 DN-KASHΔPPPL
Plasmid#129280PurposeTet-ON inducible lentivirus expressing mcherry-labeled DN KASHΔPPPLDepositorInsertSYNE1 (SYNE1 Human)
UseLentiviralTagsmcherryMutationthe last 4 amino acids (PPPL) of the KASH domain …PromoterCMVAvailable sinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJH-MBP-CbAgo
Plasmid#127707PurposepET His6 MBP TEV CbAgoDepositorInsertCbAgo
TagsMPBExpressionBacterialPromoterT7Available sinceJune 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
SECURE BE3(R33A/K34A)-P2A-EGFP (pJUL1410)
Plasmid#123615PurposeCAG promoter expression plasmid for rAPOBEC1(R33A/K34A)-XTEN-hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP (SECURE variant BE3-R33A/K34A).DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBE3(R33A/K34A)-P2A-EGFP
ExpressionMammalianMutationR33A/K34A in rAPOBEC1, D10A in SpCas9PromoterCAGAvailable sinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-pre-Ost1-alphaf(I)-E2-Crimson
Plasmid#117661PurposeTest intracellular localisation of E2-Crimson and study the secretion efficiencyDepositorInsertpre-Ost1-alphaf(I)-E2-Crimson
ExpressionYeastMutationThis plasmid encodes the fluorescent protein E2-C…PromoterpAOX1Available sinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
PtPuc3_diaCas9_sgRNA
Plasmid#109219PurposeEpisome based vector with CRISPR/Cas9_sgRNA module for genome editing in Phaeodactylum tricornutumDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsLHCF2 promoter
diaCas9
LHCF1 terminator
U6 promoter
sgRNA
U6 3' region
UseCRISPR and Synthetic BiologyPromoterLHCF1 terminator, LHCF2 promoter, U6 3' regi…Available sinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
LentiV_Neo_LKB1
Plasmid#108111PurposeLentiviral expression plasmid of human LKB1 cDNA with neomycin resistance geneDepositorInsertLKB1 (STK11 Human)
UseCRISPR and LentiviralTagsFLAGExpressionMammalianPromoterEFS promoterAvailable sinceApril 5, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
CD8a-EGFP
Plasmid#86051PurposeA mammalian expression plasmid encoding CD8a with a C-terminus EGFP.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCD8a (CD8A Human)
TagsGFPExpressionMammalianPromoterCMVAvailable sinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDONR223_IDH1_p.R132H
Plasmid#81686PurposeGateway Donor vector containing IDH1, part of the Target Accelerator Plasmid Collection.DepositorAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDONR223_MYC_WT
Plasmid#82927PurposeGateway Donor vector containing MYC, part of the Target Accelerator Plasmid Collection.DepositorAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDONR223_RELB_WT
Plasmid#82232PurposeGateway Donor vector containing RELB , part of the Target Accelerator Plasmid Collection.DepositorAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
SRC_HUMAN_D0
Plasmid#79700PurposeThis plasmid encodes the kinase domain of SRC. Intended for co-expression with YopH Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable sinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by