We narrowed to 5,202 results for: Mos;
-
Plasmid#176997PurposeMammalian lentiviral expression vector encoding JAM2DepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only
-
CRYZL1_pLENTI-CAG-IRES-GFP
Plasmid#177004PurposeMammalian lentiviral expression vector encoding CRYZL1DepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
KCNJ15_pcDNA6.2/EmGFP-Bsd
Plasmid#176981PurposeMammalian expression vector encoding KCNJ15 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRYZL1_pcDNA6.2/EmGFP-Bsd
Plasmid#176941PurposeMammalian expression vector encoding CRYZL1 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCA528 CHMP1B 4-199
Plasmid#115325PurposeExpresses residues 4-199 of CHMP1B from a His-SUMO bacterial expression vector. Internal ID: WISP 18-23DepositorAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 4-178
Plasmid#108284PurposeExpresses residues 4-178 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-279DepositorInsertCHMP1B (CHMP1B Human)
TagsGSTExpressionBacterialMutationdeleted amino acids 1-3 and 179-199Available SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ir7f-T2A-QF2 HDR plasmid
Plasmid#140942PurposePlasmid for CRISPR-generated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment into the coding sequence of the endogenous Aedes aegypti Ir7f geneDepositorInsertIr7f-left-HDR-arm; T2A-QF2-SV40; 3xP3-dsRed-SV40; Ir7f-right-HDR-arm
Mutation4 point mutations (annotated on plasmid map) were…Available SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR3-vsv-AuroraB L154A/H250Y
Plasmid#108489Purposeexpression of vsv-AuroraB Analog sensitive (L154A/H250Y)DepositorInsertAuroraB (AURKB Human)
TagsVSVExpressionMammalianMutationAnalog sensitive L154A/H250YPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno BN
Plasmid#101823PurposeAdenovirus for the expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1DepositorUseAdenoviralTagsFLAG-Cas9Available SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + Z-AAT target
Plasmid#86007Purposelenti reporter plasmid with Z-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
Z-AAT target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + TTR target
Plasmid#86009Purposelenti reporter plasmid with TTR_V30M-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
TTR target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-FHC-POLQ-DY2230AA
Plasmid#64878Purposelentiviral expression of human POLQ -DY2230AA mutant (a polymerase domain mutant)DepositorInsertPOLQ (POLQ Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationD2330A,Y2331A, in the DNA polymerase domain (POL)…PromoterEF1alphaAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin I tension sensor (F40-based)
Plasmid#119186PurposeThe F40-based human desmoplakin I tension sensor detects forces in the range of 1-6 pN by changes in FRET between mTFP1 and mEYFP.DepositorInserthuman Desmoplakin I-[mTFP1-F40-mEYFP] (internal-1945) (DSP Human)
UseTransposonTagsmTFP1-F40-mEYFPExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterTCEAvailable SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pThermoCas9i_ctrl
Plasmid#100982PurposeExpresses the catalytically inactive version of ThermoCas9 (Thermo(d)Cas9) and its sgRNA moduleDepositorInsertsCatalytically inactive variant of the Cas9 from the type IIc CRISPR-Cas sytem of Geobacillus thermodenitrificans T12 strain
ThermoCas9 single guide RNA expressing module
TagsNoneExpressionBacterialMutationchanged aspartate 8 to alanine and histidine 582 …PromoterB. coagulans DSM 1 pta promoter and B. smithii xy…Available SinceNov. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin I no force control (F40-based)
Plasmid#119187PurposeThe no force control for the F40-based human desmoplakin I tension sensor serves to detect changes in FRET between mTFP1 and mEYFP that are tension-independent.DepositorInserthuman Desmoplakinhuman Desmoplakin I (1-1945)-[mTFP1-F40-mEYFP] (DSP Human)
UseTransposonTagsmTFP1-F40-mEYFPExpressionMammalianMutationtruncation after aa1945PromoterTCEAvailable SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
TK4-NLS-EGFP
Plasmid#239046PurposePiggyBac plasmid for stable transgene expression during human pluripotent stem cell differentiationDepositorInsertsEGFP
puroR-T2A-mycNLS-mTagBFP2
TagsT2A-mycNLS-mTagBFP2 and c-myc-NLSExpressionMammalianPromoterCAG and EF1aAvailable SinceMay 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-Zim3-dCas9-P2A-EGFP
Plasmid#188899PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLS, and GFP linked by a P2A site from a SFFV promoter with an upstream ubiquitous chromatin opening elementDepositorInsertZim3-dCas9
UseLentiviralTagsHA-2xNLS, P2A-GFP, and Zim3 KRAB-NLS fusionPromoterSFFVAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAS
Plasmid#60847PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeastDepositorInsertsS. pyogenese Cas9
RNA pol III promoter (tRNA-Tyr)
hepatitis delta virus ribozyme, genomic
sgRNA
UseCRISPR and Synthetic BiologyTagsNLS/His8 and TTT 3' extension prior to sgRNAExpressionBacterial and YeastMutationL4 is UUCG tetraloop and guide targets LYP1 (CATA…Available SinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only