We narrowed to 170,492 results for: addgene
-
Plasmid#232981PurposeGalactose iduced expression of Gcn4 StoL in yeastDepositorInsertGcn4 StoL
TagsTEV cleavage siteExpressionYeastMutationS104L, S117L, S136L, S144LPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 R3W
Plasmid#232975PurposeGalactose iduced expression of Gcn4 R++ W+ in yeastDepositorInsertGcn4 R++ W+
Tags3xHA and TEV cleavage siteExpressionYeastMutationD103R, N126W, D133R, K143RPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 WT 44mer
Plasmid#232956PurposeGalactose iduced expression of Gcn4 WT 44mer in yeastDepositorInsertGcn4 WT 44mer
TagsTEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 E3HA
Plasmid#232996PurposeGalactose iduced expression of Gcn4 E+HA in yeastDepositorInsertGcn4 E+
Tags3xHA and TEV cleavage siteExpressionYeastMutationD105E, D118E, D139EPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 WW+
Plasmid#232984PurposeGalactose iduced expression of Gcn4 WW+ in yeastDepositorInsertGcn4 WW+
TagsTEV cleavage siteExpressionYeastMutationE109N, S117D, T121W, N126W, T132WPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 ILVtoAS
Plasmid#232959PurposeGalactose iduced expression of Gcn4 ILVtoAS in yeastDepositorInsertGcn4 ILVtoAS
TagsTEV cleavage siteExpressionYeastMutationL123S, I128S, V130A, V135A, L137S, I142SPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 WT 44merGFP
Plasmid#233000PurposeGalactose iduced expression of Gcn4 WT 44merGFP in yeastDepositorInsertGcn4 WT 44mer
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 WT 30mer
Plasmid#232986PurposeGalactose iduced expression of Gcn4 WT 30mer in yeastDepositorInsertGcn4 WT 30mer
TagsTEV cleavage siteExpressionYeastPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHW1133
Plasmid#229869PurposeDestination RMCE vector containing FRT::SA::51-bp Artificial exon::3xStop::SL2::SapI Insertion sites (to clone new driver with 3'UTR in slot 5 and SEC in slot 6)::reverse FRT3 to swap driver via RMCEDepositorTypeEmpty backboneExpressionWormAvailable SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
N-Terminal Halo XRCC4
Plasmid#207541PurposeHomologous recombination donor to insert halo tag at the N terminal of the endogenous XRCC4 locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human XRCC4 locus sequences
TagsHaloTagExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
N-terminal Halo-Ku70
Plasmid#207547PurposeHomologous recombination donor to insert halo tag at the N terminal of the endogenous Ku70 locus.DepositorInsertHaloTag with flanked by human Ku70 locus sequences
TagsHaloTagExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
aTY173_pPGK1_mTagBFP2_WPRE
Plasmid#225352PurposeLentiviral vector for BFP expressionDepositorInsertBFP
UseLentiviralExpressionMammalianAvailable SinceDec. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Puro-2xMS2
Plasmid#212627PurposeMS2 hairpin-containing expression vector and sgRNA entry plasmid for the directed export of barcode transcripts in Gag-MCP virus-like particlesDepositorInsertEF1a-PuroR-2xMS2-WPRE-hU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Puro-12xMS2
Plasmid#212628PurposeMS2 hairpin-containing expression vector and sgRNA entry plasmid for the directed export of barcode transcripts in Gag-MCP virus-like particlesDepositorInsertEF1a-PuroR-12xMS2-WPRE-hU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZB573_pB1H1_T7-RNAP_LARP-I5CHO_1
Plasmid#228508PurposeBacterial Hybrid Driver PlasmidDepositorInsertT7 RNAP, LARP-I5CHO (#1)
UseSynthetic BiologyTagsUmu Degron, GTG-start codonMutationR378K; S430P, N433T, S633P, F849I, F880Y; W727G, …Available SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZB578_pB1H1_T7-RNAP_LARP-I
Plasmid#228507PurposeBacterial Hybrid Driver PlasmidDepositorInsertT7 RNAP, LARP-I
UseSynthetic BiologyTagsUmu Degron, GTG-start codonMutationR378K; S430P, N433T, S633P, F849I, F880Y; W727G, …Available SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX458-PLK4
Plasmid#227310PurposeExpresses SpCas9 and a sgRNA targeting the C-terminus of PLK4 for knock-in.DepositorAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only