We narrowed to 69 results for: Tfg
-
Plasmid#30145DepositorInserthuman APP 695 Swedish/Indiana mutation (APP Human)
UseTagsExpressionMammalianMutationSwedish and Indiana; K595N, M596L and V642FPromoterAvailable sinceAug. 22, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-TGFa-ScNeo
Plasmid#209895PurposeTo monitor the status of TGFα, the plasmid encodes a recombinant TGFα fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertTGFa-ScNeo (TGFA Human)
UseLentiviralTagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…ExpressionMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-Sac-Abeta(MC1-42)
Plasmid#127151PurposeExpresses N-terminal cysteine Abeta(1-42)DepositorInsertAbeta(MC1-42) (APP Human)
UseTagsExpressionBacterialMutationPromoterT7Available sinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-Sac-Aβ(M1-42/C18C33)
Plasmid#173759PurposeExpresses the AβC18C33 peptide.DepositorInsertAβ(M1-42/C18C33) (APP Human)
UseTagsExpressionBacterialMutationchanged valine 18 to cysteine; changed glycine 33…PromoterT7Available sinceAug. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-MBP-TEV-AICD
Plasmid#69927Purposebacterial expression of MBP-TEV-AICDDepositorInsertAICD (APP Human)
UseTagsMBP-TEVExpressionBacterialMutation47 aa longPromoterT7Available sinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAX APPs-751-alpha
Plasmid#30149DepositorInsertAmyloid Precursor Protein - soluble (APP Human)
UseTagsExpressionMammalianMutationsplice variant 751; amino acids 1–612PromoterAvailable sinceJuly 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pPBbleo-TGFa-ScNeo
Plasmid#209904PurposeTo monitor the status of TGFα, the plasmid encodes a recombinant TGFα fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertTGFa-ScNeo (TGFA Human)
UseTagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…ExpressionMammalianMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-TGFa-ScNeo
Plasmid#209908PurposeTo monitor the status of TGFα, the plasmid encodes a recombinant TGFα, fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertTGFa-ScNeo (TGFA Human)
UseTagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…ExpressionMammalianMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-Sac-Abeta(M1-42)
Plasmid#71875PurposeExpresses the amyloid-beta protein (42 aa), containing an exogenous methionine (Abeta(M1-42)), when expressed in BL21* DE3 p LysS E. coli cellsDepositorInsertAbeta(M1-42) (APP Human)
UseTagsExpressionBacterialMutationPromoterT7Available sinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET-Sac-Abeta(M1-40)
Plasmid#71876PurposeExpresses the amyloid-beta protein (40 aa), containing an exogenous methionine (Abeta(M1-40)), when expressed in BL21* DE3 p LysS E. coli cellsDepositorInsertAbeta(M1-40) (APP Human)
UseTagsExpressionBacterialMutationPromoterT7Available sinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-APPSw;T719N
Plasmid#177094PurposeFor lentiviral transduction of APPsw; T719NDepositorInsertAPPsw;T719N (APP Human)
UseLentiviralTagsExpressionMutationT719N, K651N and M652L (please see depositor comm…PromoterAvailable sinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-APP751
Plasmid#193772PurposeEntry vector for human APP isoform having 751 amino acid residuesDepositorInsertAPP (APP Human)
UseTagsExpressionMutationPromoterAvailable sinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
HA-APP-mGFP
Plasmid#196696PurposeExpresses APP695 with an HA tag an N-terminal for single molecule tracking and other measusers in mammalian cellsDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
UseTagsHA and mGFPExpressionMammalianMutationPromoterAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
APP-bio-His
Plasmid#51643PurposeExpresses full-length Amyloid beta A4 protein precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertAPP (APP Human)
UseTagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUCIDT-attL1-Human ABeta-attR5
Plasmid#160436PurposeEntry vector for cloning human Amyloid Beta(1-42) using 2-fragment gateway recombinationDepositorInsertHomo sapiens amyloid beta precursor protein (APP Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
APP_pcDNA6.2/EmGFP-Bsd
Plasmid#176954PurposeMammalian expression vector encoding APP and EmGFP-BsdDepositorInsertAPP (APP Human)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
mBFP-APP-mGFP
Plasmid#196694PurposeExpresses APP695 with two fluorescent proteins at the ends to follow processing in mammalian cellsDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
UseTagsmEGFP and mtagBFP2ExpressionMammalianMutationPromoterCMVAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-APP-mGFP
Plasmid#196704PurposeExpresses APP695 with two fluorescent proteins at the ends to follow processing in mammalian cellsDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
UseTagsmCherry and mEGFPExpressionMammalianMutationPromoterAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-APPP1-mGFP
Plasmid#196705PurposeAs mCherry-APP-mGFP, but with substitution at position 612 that prevents alpha-secretase activityDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
UseTagsmCherry and mEGFPExpressionMammalianMutationLys to Val substitution at position 612PromoterAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
mBFP-APPP1-mGFP
Plasmid#196695PurposeAs mBFP-APP-mGFP, but with substitution at position 612 that prevents alpha-secretase activityDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
UseTagsmEGFP and mtagBFP2ExpressionMammalianMutationLys to Val substitution at position 612PromoterCMVAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-AICD-IRES-hrGFP
Plasmid#107548Purposehigh transduction efficiency AAV-mediated synapsin promoter-dependent expression of AICD (last 50 amino acids of APP) and IRES-mediated co-expression of hrGFPDepositorInsertAICD (APP Human)
UseAAVTagsExpressionMutationNonePromoterhuman synapsinAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
AP-APP
Plasmid#196706PurposeExpresses APP695 with a biotin Acceptor Peptide tag at N-terminal for single molecule tracking and other measusers in mammalian cellsDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
UseTagsAP, Avitag and HAExpressionMammalianMutationPromoterAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Tol2-PA2-CMV-AB-mCh
Plasmid#160435PurposeExpresses human Amyloid Beta-mCherry in ZebrafishDepositorInsertHuman Amyloid Beta peptide (1-42) (APP Zebrafish, Human)
UseZebrafish expressionTagsmCherryExpressionMutationPromoterCMVAvailable sinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCB268
Plasmid#53363PurposepcDNA3.0-based plasmid encoding fDHFR-UbK48R-Aβ42 13myc under the control of T7 or CMV promoter for 35S-pulse-chase URT-based assays in rabbit reticulocyte extract.DepositorUseTags13xMyc, Flag, and HAExpressionMammalianMutationPromoterCMVAvailable sinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NLS (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUCIDT-attL1-Worm ABeta-attR5
Plasmid#160437PurposeEntry vector for cloning nematode-codon-optimized Amyloid Beta(1-42) using 2-fragment gateway recombinationDepositorInsertHomo sapiens amyloid beta precursor protein (APP Human, Nematode)
UseTagsCleavage signalExpressionBacterialMutationCodon-optimized for expression in C. elegansPromoterAvailable sinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NES (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPBbleo-TGFa-EREG-ScNeo
Plasmid#209915PurposeTo express the chimeric protein of TGFα and EREG, which a recombinant TGFα protein fused extracellularly to the mScarlet and a recombinant Epiregulin protein fused intracellularly to the mNeonGreenDepositorUseTagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…ExpressionMammalianMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only