We narrowed to 7,680 results for: Trac
-
Plasmid#160650PurposeExpresses Human APOE4 with a yeast secretory signal peptide under the control of the yeast Gal promoterDepositorInsertApolipoprotein E e4 (APOE Human)
TagsKar2 signal sequenceExpressionYeastMutatione4 allelePromoterGAL1Available SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Beta1
Plasmid#140987PurposeEncodes a Gbeta subunit (GNB1) as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGBeta1 (GNB1 Human)
ExpressionMammalianMutationContains an N-terminal human rhinovirus (HRV) 3C …PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
EGFPC2-Gephyrin P1
Plasmid#68815Purposeexpression of fluorescent tagged Geph in mammalian cellsDepositorInsertGephyrin (Gphn Rat)
TagsEGFPExpressionMammalianMutationsilent mutations on internal EcoRI site. Gephyri…PromoterCMVAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
NONO2_IDR-EGFP
Plasmid#232758PurposeExpresses NONO2_IDR-EGFPDepositorAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-M13-6His-KIF1C-GFP
Plasmid#130975PurposeExpression of 6His-KIF1C-GFP in insect cells for protein purification.DepositorInsertKIF1C-GFP (KIF1C Human)
Tags6His and GFPExpressionInsectMutation5 silent mutations that make this construct RNAi …PromoterPolyhedrinAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-AREG-ScNeo
Plasmid#209897PurposeTo monitor the status of Amphiregulin, the plasmid encodes a recombinant AREG fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-PLXNB2-shRNA1
Plasmid#98399PurposeLentivirus for expression of shRNA1 against human PLEXIN-B2 (Dox-inducible)DepositorInsertPlexin-B2 (PLXNB2 Human)
UseLentiviralAvailable SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHLS-EF1a-FRB-SpCas9-A
Plasmid#138477PurposeExpresses FRB fused SpCas9 for NanoMEDIC packaging.DepositorInsertSpCas9, human codon optimized
UseCRISPRTags3x HA tag and FRBExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-AREG-ScNeo
Plasmid#209910PurposeTo monitor the status of Amphiregulin, the plasmid encodes a recombinant AREG fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphaGustducin-RLuc8
Plasmid#140979PurposeEncodes a G alpha subunit (GNAT3) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphaGustducin-RLuc8 (GNAT3 Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
tetO-HAND2
Plasmid#170690Purposedoxycycline-inducible overexpression of HAND2DepositorInsertHAND2 (HAND2 Human)
UseLentiviral; Doxycycline inducibleExpressionMammalianPromoterTRE promoter, Tet-ONAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSH1/M-FGFR1-Fv-Fvls-E
Plasmid#15285DepositorInsertFGFR1 kinase, FKBP12v36 (Fgfr1 Mouse)
TagsHA epitope and Myristoylation-targeting domain c-…ExpressionMammalianMutationFGFR1 cytoplasmic domain FKBP12 F36VAvailable SinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-EREG-ScNeo
Plasmid#209896PurposeTo monitor the status of Epiregulin, the plasmid encodes a recombinant Epiregulin fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertEREG-ScNeo (EREG Human)
UseLentiviralTagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…Available SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-EPGN-ScNeo
Plasmid#209899PurposeTo monitor the status of Epigen, the plasmid encodes a recombinant Epigen fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL 5N>Q
Plasmid#202419PurposeExpression of GFP-tagged PODXL with mutated N-linked glycosylation sitesDepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
ATX3-13Q
Plasmid#184248PurposeRecombinant protein expression and purification. Encodes ataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track fused with His-Tag and TEV cleavage sequence (N-terminal)DepositorInsertataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track (ATXN3 Human, Synthetic)
Tags6x His-Tag and TEV cleavage siteExpressionBacterialMutationC-terminal codon optimization for protein expres…PromoterT7 promoterAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-EGF-ScNeo
Plasmid#209893PurposeTo monitor the status of EGF, the plasmid encodes a recombinant EGF fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only