We narrowed to 6,293 results for: cat.2
-
Plasmid#100147PurposeExpresses EIF3EDepositorAvailable SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only
-
p7136 pHAGE-P-CMVt-N-HA-GAW-EIF3H
Plasmid#100148PurposeExpresses EIF3EHDepositorAvailable SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPKm-248
Plasmid#90504PurposeExpresses HO1, PCYA, FD and FNR, required for PCB synthesis. pSIN - EF-1alpha - MTS - tPCYA - IRES - MTS - tHO1 - P2A - MTS - tFD - P2A - MTS - tFNRDepositorInsertmito-tHO1, mito-tPCYA, mito-tFD, mito-tFNR
UseLentiviralAvailable SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1_HBB_N
Plasmid#87847PurposepCR2.1-based plasmid holding a 309-bp fragment containing the exon-1-exon-2 splice border of normal human β-globin mRNADepositorInsertHomo sapiens hemoglobin subunit beta (HBB), Normal cDNA fragment (Exon1/2) (HBB Human)
ExpressionBacterialAvailable SinceOct. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPKm-105
Plasmid#104853PurposepcDNA3 - pCMV - PhyB NT - GBD, expressing Phytochrome B (PhyB) with Gal Binding Domain (GBD), under CMV promoterDepositorInsertPhyB NT GBD
ExpressionMammalianPromoterCMVAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
DNAJC11-EGFP
Plasmid#210368PurposeExpresses DNAJC11 fused with EGFP in mammalian cellsDepositorAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPKm-245
Plasmid#90503PurposeExpresses HO1, PCYA, FD and FNR, required for PCB synthesis. pSIN - EF-1alpha - MTS - tHO1 - P2A - MTS - tPCYA - P2A - MTS - tFD - P2A - MTS - tFNRDepositorInsertmito-tHO1, mito-tPCYA, mito-tFD, mito-tFNR
UseLentiviralAvailable SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
p7055 pHAGE-P-CMVt-N-HA-GAW-COPZ1
Plasmid#100145PurposeExpresses COPZ1DepositorAvailable SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPKm-244
Plasmid#90502PurposeExpresses HO1, PCYA, FD and FNR, required for PCB synthesis. pSIN - EF-1alpha - MTS - tHO1 - P2A - MTS - tPCYA - IRES - MTS - tFD - P2A - MTS - tFNRDepositorInsertmito-tHO1, mito-tPCYA, mito-tFD, mito-tFNR
UseLentiviralAvailable SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPKm-112
Plasmid#90494PurposepcDNA3 - pCMV - MTAD - PIF3, expresses Phytochrome interacting factor 3 (PIF3) and minimal transactivation domain (MTAD), under CMV promoterDepositorInsertMTAD-PIF3
ExpressionMammalianAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO_TAP_FAM86A
Plasmid#85116Purposemammalian expression of FAM86ADepositorAvailable SinceNov. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPKm-231
Plasmid#90500PurposepSIN - EF-1alpha - MTS - tFd - P2A - MTS - tFNR, vector encoding for mitochondrial-tagged Thermosynechococcus elongates Ferredoxin (Fd) and Ferredoxin-NADP(+) oxireductase (FNR), under EF-1alpha promoterDepositorInsertmito-tFD and mito-tFNR
UseLentiviralAvailable SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPKm-232
Plasmid#90501PurposepSIN - EF-1alpha - MTS tHO1 - P2A - MTS - tPCYA, vector encoding for mitochondrial-tagged Thermosynechococcus elongates Heme Oxigenase-1 (HO1) and Phycocyanobilin:ferredoxin oxireductase, under EF-1alpha promoterDepositorInsertmito-tHO1 and mito-tPCYA
UseLentiviralAvailable SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPKm-234
Plasmid#90507PurposepSIN - EF-1alpha - MTS sHO1 - P2A - MTS - sPCYA, vector encoding for mitochondrial-tagged Synechococcus sp. Heme Oxigenase-1 (HO1) and Phycocyanobilin:ferredoxin oxireductase (PcyA), under EF-1alpha promoterDepositorInsertmito-sHO1, mito-sPCYA
UseLentiviralAvailable SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-SFFV-tagBFP-2A-FLAG-coK8
Plasmid#235542PurposeTo express tagBFP-2A-FLAG-coK8 (co = codon-optimized)DepositorInsertK8
UseLentiviralTagsFLAGAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2_IFNB1_gRNA_3
Plasmid#235533PurposegRNA against human IFNB1DepositorInsertIFNB1 (IFNB1 Human)
UseLentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only