We narrowed to 27,336 results for: sta
-
Plasmid#73093PurposeEXPRESs plasmid for human erythrocyte surface proteins encoding GlycophorinA with rat CD4d3+4-bioDepositorInsertGlycophorin A (GYPA Human)
Tagsbiotinylation peptide and ratCD4d3+4ExpressionMammalianPromoterCMVAvailable SinceMarch 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pICSL11055
Plasmid#68252PurposeLevel 1 Golden Gate Cassette: Plant kanamycin resistance cassetteDepositorInsertPromoter:2x35s+5'UTR:Omega+CDS:nptII+3'UTR/terminator:Nos
UseSynthetic BiologyExpressionPlantAvailable SinceSept. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pICE-HA-CtIP-siR-WT
Plasmid#82030PurposePlasmid for constitutive or doxycycline-inducible expression of human CtIP resistant to a siRNA. Confers resistance to puromycin. Use T-REx cells for doxycycline-inducible expression.DepositorInsertCtIP (RBBP8 Human)
TagsHAExpressionMammalianMutationMutations making the cDNA resistant to a siRNAPromoterCMV-tetAvailable SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
ePB-PURO-FLAG-METTL3
Plasmid#160252PurposeFor stable integration of FLAG-METTL3 in human cells with trasposaseDepositorInsertmethyltransferase like 3 (METTL3 Human)
TagsFLAGExpressionMammalianPromotertight TRE promoterAvailable SinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEmpty
Plasmid#214051PurposeEmpty bacterial expression vector with CloDF13 (CDF) origin of replication; used as a negative control in the Haliangium ochraceum type III CRISPR-Cas systemDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
CMV:: HA-hM4Dnrxn
Plasmid#52525PurposeExpresses N-terminal HA tagged hM4DnrxnDepositorAvailable SinceApril 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pODN-AAVS1-mR2-CAAX
Plasmid#183871PurposeRepair template for the stable expression of a mRuby2-CAAX fusion in human cells using CRISPR/Cas9.DepositorInsertAAVS1 homology arms with CMV-driven mRuby2-CAAX fusion (AAVS1 Human)
UseCRISPR; Donor templateTagsmRuby2-CAAXExpressionMammalianMutationHomology arms contain point mutations to remove t…PromoterCMVAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKT2/CAGXSP/PalmNanoLuc
Plasmid#182969PurposeStably express PalmNanoLuc in mammalian cells via the sleeping beauty transposon system.DepositorInsertPalmNanoLuc
ExpressionMammalianMutationN/AAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
CIAR_pcDNA5/FRT/TO
Plasmid#86502PurposeExpresses CIAR in mammalian cells. Used to generate Flp-In stables.DepositorInsertCIAR (SOS1 Human)
UseFrtExpressionMammalianMutationT968L in SOScatPromoterCMV (tet operator)Available SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCS2z-tal1
Plasmid#164656Purposefor the synthesis of zebrafish tal1 mRNADepositorAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVX-mCherry-SPASTIN, F124D
Plasmid#180648PurposeLentiviral expression vector for SPASTIN. Has F124D mutation. Used for generating cell lines. Has N-terminal mCherry tag. Dox-inducible. SPASTIN starts on M87. Internal ID: WISP20-44.DepositorInsertSPASTIN
UseLentiviralTagsmCherryExpressionMammalianMutationStarts at M87, F124D mutation, has siRNA resistan…Available SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO-1: shALAS-1
Plasmid#22750DepositorAvailable SinceDec. 3, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAdTrack: shRev-Erbalpha
Plasmid#22749DepositorAvailable SinceJune 2, 2010AvailabilityAcademic Institutions and Nonprofits only -
pBW_0001
Plasmid#102833PurposeBinary vector containing Sr22 Schomburgk allele driven by maize ubiquitin promoter, Sr22 terminatorDepositorAvailable SinceFeb. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-B-pCR
Plasmid#46369DepositorAvailable SinceJuly 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
TFORF1510
Plasmid#144365PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMADM-alpha
Plasmid#36890DepositorInsertsGFP
tdTomato-3Myc
beta-globin intron
Neo
ATG (T)
GFP
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, deleted…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL2
Plasmid#196691PurposeRep/Cap plasmid for the production of PAL2, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationPTQGTVR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only