We narrowed to 89,479 results for: MAL
-
Plasmid#123967PurposeEncodes the hROSA26 BxBI recognition site with Hygromycin resistance and mRuby2 landing pad with GFP dropout destination vector as a type 0 part to be used in the MTK systemDepositorInserthRosa26-BxBI landing pad
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
LITE1.0_pAAV_hSyn_CRY2PHR-NLS-VP64_2A_GFP_WPRE_bGHpA
Plasmid#48253PurposeLITE1.0 CRY2PHR fused to VP64 transcriptional activator domain. Binds to CIB1 upon blue light stimulation. Synapsin promoter for neuronal expression. See LITE2.0 for optimized LITE activators.DepositorInsertCRY2PHR-NLS-VP64
UseAAV; TaleTags2A_GFPExpressionMammalianPromoterEF1-alphaAvailable SinceOct. 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-fTCAP-GFP
Plasmid#22916DepositorInsertfugu titan cap promoter driving GFP
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
p_3xFLAG-Rpp25
Plasmid#87194PurposeExpression of ectopic 3xFLAG-Rpp25 construct from CMV promoterDepositorAvailable SinceMarch 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
p21 promoter D
Plasmid#16465DepositorInsertp21 promoter (CDKN1A Human)
ExpressionMammalianAvailable SinceApril 7, 2008AvailabilityAcademic Institutions and Nonprofits only -
GST-TEVcs-GFP-ATG101
Plasmid#171415PurposeFor the purifcation of GFP-ULK1 complexDepositorInsertATG101 (ATG101 Synthetic)
ExpressionMammalianAvailable SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_m4_KRAB_EBFP2
Plasmid#167873PurposePiggyBac compatible plasmid expressing dCas9-KRABDepositorInsertdCas9-KRAB
UseCRISPRMutationD10A, D839A, H840A, N863AAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
GST-GFP-ATG14
Plasmid#171426PurposeFor the purifcation of GFP- PI3KC3 complexDepositorInsertATG14 (ATG14 Human)
ExpressionMammalianAvailable SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-p97-RG-mycStrep
Plasmid#31840DepositorInsertp97
TagsStrep and mycExpressionBacterial and MammalianMutationR95GPromoterCMVAvailable SinceOct. 20, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCSDest2-SpCas9-WT-NLS-3XHA-NLS-ZFP_TS3
Plasmid#69226PurposeExpresses wild type SpCas9 fused to ZFP-TS3 in mammalian cellsDepositorInsertTS3 ZFP
UseCRISPRTagsNLS-3XHA-NLSExpressionMammalianAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCD5-ss-D/bovine/France/5920/2014-HEFwtED-GCN4-sfGFP-ST
Plasmid#175017PurposeExpresses influenza D virus trimeric hemagglutinin esterase fusion protein fused to a sfGFPDepositorInsertOK-HEFwtED
TagsGCN4-TEV-sfGFP-TwinStrepExpressionMammalianPromoterCMVAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hHIF1 alpha-IGd2
Plasmid#22535PurposeTo be used for the RNAi screening purposes (not for HDAC4 expression); see paperDepositorInserthypoxia inducible factor 1 alpha (HIF1A Human)
ExpressionMammalianAvailable SinceNov. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
p21 promoter F
Plasmid#16467DepositorInsertp21 promoter (CDKN1A Human)
ExpressionMammalianAvailable SinceApril 7, 2008AvailabilityAcademic Institutions and Nonprofits only -
Short fibulin-3-V5 pcDNA4
Plasmid#29702DepositorInsertEFEMP1 (EFEMP1 Human)
TagsV5ExpressionMammalianMutationlacks N-terminus of EFEMP1 (amino acids 1-105)Available SinceAug. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
JPF0454
Plasmid#124039PurposeEncodes pPGK1 driving expression of spCas9 P2A mAzamiGreen in a 2nd gen. Lenti Virus destination vectorDepositorInsertpHR_pPGK1-spCAS9-P2A-mAzamiGreen
ExpressionMammalianAvailable SinceFeb. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
cmamxA1-GFP
Plasmid#107195PurposeExpresses porcine annexin A1-GFP fusion protein for live cell imaging, all type II Ca2+ binding sites deletedDepositorInsertcmannexin A1
TagsGreen Fluorescent ProteinExpressionMammalianMutationexchanges Asp170Ala, Glu255Ala, Glu330Ala, all ty…PromoterCMVAvailable SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDF1-PTPRD-G1707R
Plasmid#32526DepositorInsertProtein tyrosine phosphatase receptor-type delta G1707R (PTPRD Human)
UseLentiviralExpressionMammalianMutationG1707RAvailable SinceNov. 9, 2011AvailabilityAcademic Institutions and Nonprofits only -
pKD011 CMV 3xFLAG-NLS-ZF2-ABI1 in TUPV2
Plasmid#161548PurposeConstitutive expression of 3xFLAG-NLS-ZF2-ABI1 under the CMV promoterDepositorInsert3xFLAG-NLS-ZF2-ABI1
UseSynthetic BiologyTags3x-FLAGExpressionMammalianPromoterCMVAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
MTK234_027
Plasmid#123907PurposeEncodes the spCas9 sgRNA1 hThal5.10-2_hg18 (site 1) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertsgRNA1 -hThal5.10-2_hg18
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDF-NtXNtT5R1AtR2NtB2
Plasmid#160888PurposeExpression of N. tabacum Rubisco small subunit (rbcS-T5), Rubisco chaperone protiens rbcX, raf1, bsd2 and A. thaliana Rubisco chaperone proteins raf2 in E. coli.DepositorInsertPT7-Nt-rbcS-T5
ExpressionBacterialPromoterrbcS-T5: T7, chaperones: T11Available SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDF-NtXNtT1R1AtR2NtB2
Plasmid#160885PurposeExpression of N. tabacum Rubisco small subunit (rbcS-T1), Rubisco chaperone protiens rbcX, raf1, bsd2 and A. thaliana Rubisco chaperone proteins raf2 in E. coli.DepositorInsertPT7-Nt-rbcS-T1
ExpressionBacterialPromoterrbcS-T1: T7, chaperones: T8Available SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDF-NtXNtS5R1AtR2NtB2
Plasmid#160884PurposeExpression of N. tabacum Rubisco small subunit (rbcS-S5), Rubisco chaperone protiens rbcX, raf1, bsd2 and A. thaliana Rubisco chaperone proteins raf2 in E. coli.DepositorInsertPT7-Nt-rbcS-S5
ExpressionBacterialPromoterrbcS-S5: T7, chaperones: T7Available SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDF-NtXNtS2R1AtR2NtB2
Plasmid#160883PurposeExpression of N. tabacum Rubisco small subunit (rbcS-S2), Rubisco chaperone protiens rbcX, raf1, bsd2 and A. thaliana Rubisco chaperone proteins raf2 in E. coli.DepositorInsertrbcS-S2, rbcX, raf1, raf2, bsd2
ExpressionBacterialPromoterrbcS-S2: T7, chaperones: T7Available SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJM582 EF1α 3xFLAG-NLS-VP64-ZF2 in TUPV2
Plasmid#161543PurposeConstitutive expression of 3xFLAG-NLS-VP64-ZF2 under the EF1α promoterDepositorInsert3xFLAG-NLS-VP64-ZF2
UseSynthetic BiologyTags3x-FLAGExpressionMammalianPromoterEF1αAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJM465 EF1α 3xFLAG-NLS-VP64-ZF1 in TUPV2
Plasmid#161533PurposeConstitutive expression of 3xFLAG-NLS-VP64-ZF1 under the EF1α promoterDepositorInsert3xFLAG-NLS-VP64-ZF1
UseSynthetic BiologyTags3x-FLAGExpressionMammalianPromoterEF1αAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDF1-PTPRD-P1690F
Plasmid#32525DepositorInsertProtein tyrosine phosphatase receptor-type delta P1690F (PTPRD Human)
UseLentiviralExpressionMammalianMutationP1690FAvailable SinceNov. 9, 2011AvailabilityAcademic Institutions and Nonprofits only -
pUB6_ATR
Plasmid#84016PurposeATR minigene to test splicing eventDepositorAvailable SinceJan. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR_Hu_Plk5(WT)
Plasmid#136329PurposeHuman Plk5 WT in Gateway pENTRDepositorInsertPLK5 (PLK5 Human)
UseGateway entry vectorAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMX Vav1 Y3F/DH* (L213Q) uGFP
Plasmid#14559DepositorInsertVav1 (VAV1 Human)
UseRetroviralTagsGFPExpressionMammalianMutationY3F (Y142, Y160, Y174)/DH* (L213Q)Available SinceApril 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
MTK0_001
Plasmid#123924PurposeEncodes the spCas9 gRNA GFP dropout expression cassette with ConLS and ConRE connectors with Ampicillin resistance as a type 0 part to be used in the MTK systemDepositorInsertTU-sgRNA - L1/RE
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCALNL_chr13_102010574-102010650
Plasmid#81213PurposepCALNL reporter contains two target sites consisting of PAM Cas9 site-gix psuedo site-Cas9 site-PAM that match region in centromeres of chromosomes 13 (numbers in common name refers to pos. in hg38)DepositorInsertgix-Neo-gix deletion cassette upstream of EGFP
ExpressionMammalianPromoterpCBaAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
MTK234_055
Plasmid#123920PurposeEncodes the spCas9 gRNA GFP dropout expression cassette (bovine u6 promoter and constant region 2) as a type 234 part to be used in the MTK systemDepositorInsertgRNA-GFPDROPOUT-for Sp Cas9 bu6_20N_cr2
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDEF3‐mTim1 (no tag)
Plasmid#49206Purposeexpresses mouse Tim1DepositorAvailable SinceDec. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV-myc-CD4-Sema4D
Plasmid#51603Purposeexpresses Sema4D/CD4 chimera with intracellular Sema4D, extracellular CD4DepositorInsertCD4-Sema4D
TagsmycExpressionMammalianMutationSema4D amino acids 1-754 have been replaced with …PromoterCMVAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCALNL_Ch12_62418577-62418652
Plasmid#81212PurposepCALNL reporter contains two target sites consisting of PAM Cas9 site-gix psuedo site-Cas9 site-PAM that match region in centromeres of chromosomes 12 (numbers in common name refer to pos. in hg38)DepositorInsertgix-Neo-gix deletion cassette upstream of EGFP
ExpressionMammalianPromoterpCBaAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAG176 SLC23A2 3'UTR mut
Plasmid#12034DepositorInsertN9 3'UTR mut (SLC23A2 Human)
UseLuciferaseExpressionMammalianMutationMutations in microRNA recognition sites (seed mat…Available SinceJune 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
PB-BE3-3NLS
Plasmid#119032PurposeStably express BE3 in mammalian cellsDepositorInsertBE3
Tags3xFlagExpressionMammalianAvailable SinceJan. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMX Vav1 Y3F/NSH3* (P651L) uGFP
Plasmid#14562DepositorAvailable SinceApril 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
MTK0_049
Plasmid#123946PurposeEncodes the hThal5.10-2_hg18 landing pad destination vector as a type 0 part to be used in the MTK systemDepositorInserthThal5.10-2_hg18 landing pad destination vector
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only