We narrowed to 4,893 results for: PIR
-
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralTagsExpressionMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralTagsExpressionMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pαH-rS2d-HexaPro
Plasmid#183515PurposeMammalian cell expression of SARS-CoV-2 Spike protein rS2d-HexaPro with (682-685) furin side replaced with GSAS and mutation S383C, D985C, F817P, A892P, A899P, A942P, K986P,V987PDepositorInsertSpike (S-GSAS-rS2d.HexaPro) (S Severe acute respiratory syndrome coronavirus 2)
UseTags2X Strep-Tag II, 8X His tag, and HRV3C cleavage s…ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-AVI
Plasmid#160476PurposeExpresses SARS-CoV-2 RBD domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationPromoterAvailable SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-AVI
Plasmid#160475PurposeExpresses SARS-CoV-2 NTD domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationPromoterAvailable SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-AVI
Plasmid#160474PurposeExpresses SARS-CoV-2 S2P protein with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationPromoterAvailable SinceOct. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-RRAR-OMICRON
Plasmid#180424PurposeMammalian cell expression of SARS-CoV-2 Spike protein variant OMICRON with furin side intactDepositorInsertSpike (S-RRAR-OMICRON) (S Severe acute respiratory syndrome coronavirus 2)
UseTagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-OMICRON.BA.2
Plasmid#184829PurposeMammalian cell expression of SARS-CoV-2 Spike protein variant OMICRON.BA.2 with furin side replaced by GSAS and with 2 Proline substitution at 986 and 987DepositorInsertS-GSAS-OMICRON.BA.2 (S Severe acute respiratory syndrome coronavirus 2)
UseTagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-B.1.617.2.v1
Plasmid#182575PurposeMammalian cell expression of SARS-CoV-2 Spike protein Delta variant, furin side replaced by GSAS, 2 Proline at 986 and 987 plus T19R-G142D-del156/157-R158G-L452R-T478K-D614G-P681R-D950NDepositorInsertSpike S-GSAS-B.1.617.2.v1 (T19R-G142D-Del156/157-R158G-L452R-T478K-D614G-P681R-D950N) (S Severe acute respiratory syndrome coronavirus 2)
UseTags2X Strep-Tag II, 8X His tag, and HRV3C cleavage s…ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-SD1-AVI
Plasmid#160477PurposeExpresses SARS-CoV-2 RBD-SD1 domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-SD1
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationPromoterAvailable SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-L455RA475RG502R-AVI
Plasmid#160480PurposeExpresses SARS-CoV-2 RBD-L455RA475RG502R domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-L455RA475RG502R
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationchanged Leucine 455 to Arginine, Alanine 475 to A…PromoterAvailable SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-L455RG496R-AVI
Plasmid#160479PurposeExpresses SARS-CoV-2 RBD-L455RG496R domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-L455RG496R
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationchanged Leucine 455 to Arginine and changed Glyci…PromoterAvailable SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-L455RA475R-AVI
Plasmid#160478PurposeExpresses SARS-CoV-2 RBD-L455RA475R domain with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-L455RA475R
UseTagsAVI, HRV3C, and scFcExpressionMammalianMutationchanged Leucine 455 to Arginine and changed Alani…PromoterAvailable SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTwist-SARS-CoV-2 Δ18 B.1.1.529
Plasmid#179907PurposeEncodes SARS-CoV-2 B.1.1.529 Spike Protein lacking 18 C-terminal amino acids for pseudovirus productionDepositorInsertSARS-CoV-2 B.1.1.529 Spike truncated to remove 18 amino acids (S Severe acute respiratory syndrome coronavirus 2)
UseTagsExpressionMammalianMutationA67V; Δ69-70; T95I; G142D; Δ143-145; N211I; Δ212;…PromoterCAGAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-2P-OMICRON
Plasmid#180593PurposeMammalian cell expression of SARS-CoV-2 Spike protein variant OMICRON with furin side replaced by GSAS and with 2 Proline substitution at 986 and 987DepositorInsertSpike (S-GSAS-2P-OMICRON) (S Severe acute respiratory syndrome coronavirus 2)
UseTagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEH_AAV_TERT_prom_-124C>T_C7C_1.8kb
Plasmid#183080PurposerAAV transfer plasmid with ITRs flanking: (1) TERT -124C>T promoter and exon 1 C7C (C21>T21), 1.8kb homologous recombination donor template with ~900 bp homology arms, and (2) PGK-Puro.DepositorInsertTERT -124C>T promoter and exon 1 C7C (C21>T21), 1.8kb homologous recombination donor template with ~900 bp homology arms (TERT Human)
UseAAV; Homologous recombination donor templateTagsExpressionMutation-124C>T promoter, Exon 1 C7C (C21>T21) sile…PromoterNone for primary insert (Though partial TERT prom…Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEH_AAV_TERT_prom_-146C>T_C7C_1.8kb
Plasmid#183081PurposerAAV transfer plasmid with ITRs flanking: (1) TERT -146C>T promoter and exon 1 C7C (C21>T21), 1.8kb homologous recombination donor template with ~900 bp homology arms, and (2) PGK-Puro.DepositorInsertTERT -146C>T promoter and exon 1 C7C (C21>T21), 1.8kb homologous recombination donor template with ~900 bp homology arms (TERT Human)
UseAAV; Homologous recombination donor templateTagsExpressionMutation-146C>T promoter, Exon 1 C7C (C21>T21) sile…PromoterNone for primary insert (Though partial TERT prom…Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHis-TEV-Nsp15
Plasmid#187656PurposeE. coli plasmid (T7lac promoter) for full-length, wild-type SARS CoV-2 Nsp15 (uridine-specific nidoviral endoribonuclease, expression-optimized gene) with N-terminal TEV protease cleavable His6-tagDepositorInsertNsp15 (N Severe acute respiratory syndrome coronavirus 2)
UseTagsTEV protease cleavable His6-tagExpressionBacterialMutationnonePromoterT7lacAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-OMICRON
Plasmid#180423PurposeMammalian cell expression of SARS-CoV-2 Spike protein variant OMICRON with furin side replaced by GSASDepositorInsertSpike (S-GSAS-OMICRON) (S Severe acute respiratory syndrome coronavirus 2)
UseTagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable SinceFeb. 10, 2022AvailabilityAcademic Institutions and Nonprofits only