We narrowed to 12,043 results for: shRNA
-
Plasmid#246297PurposeEvaluation of CiU6.6c16 promoter (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertCiU6.6c16 promoter
UseCRISPRExpressionPlantMutationT-to-C (-2 from TSS)PromoterCiU6.6c16 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-11
Plasmid#246294PurposeEvaluation of CiU6.3c8 promoter (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertCiU6.3c8 promoter
UseCRISPRExpressionPlantMutationA-to-C (-23 from TSS)PromoterCiU6.3c8 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-4 (nonfunctional)
Plasmid#246287PurposeEvaluation of AtU6.1c1 promoter (nonfunctional) (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertAtU6.1c1 promoter (nonfunctional)
UseCRISPRExpressionPlantMutationG-to-C at -15 from TSSPromoterAtU6.1c1 promoter (nonfunctional)Available SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-20
Plasmid#246303PurposeEvaluation of MtU6.6-189 promoter (Pol III promoter) deletion (189 bp) for CRISPR-Cas9 editing of mEGFP in Nicotiana benthamiana and poplar reporter linesDepositorInsertMtU6.6-189 promoter
UseCRISPRExpressionPlantPromoterMtU6.6-189 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-16
Plasmid#246299PurposeEvaluation of HbU6.2m1 promoter (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertHbU6.2m1 promoter
UseCRISPRExpressionPlantMutationA-to-G (-56 from TSS), C-to-T (-29), G-to-A (-24)PromoterHbU6.2m1 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs-RMRP (pAVA3583)
Plasmid#239260PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RMRPDepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RMRP
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs-RMRP (pAVA3584)
Plasmid#239261PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RMRPDepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RMRP
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs-RPPH1 (pAVA3585)
Plasmid#239262PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RPPH1DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RPPH1
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
hDNMT3B_KO_puro
Plasmid#234998PurposeStable knockout of DNMT3B function in mammalian cellsDepositorInserthCas9
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
Scramble_gRNA_puro
Plasmid#234999Purposescramble sgRNADepositorInsertscramble sgRNA
UseLentiviralTagsEGFP:T2A:PuroExpressionMammalianAvailable SinceJuly 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459_LIG4_Exon3
Plasmid#225363PurposepX459 plasmid encoding the sgRNA protospacer sequence “5’-GCATAATGTCACTACAGATC-3’ to target the LIG4 gene.DepositorAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-GFP
Plasmid#238041PurposeEncodes sfGFP under lac promoter. Expresses a single guide RNA (under Rha promoter), which targets a noncoding region of the plasmid as part of the ADEPT system. Carries oriT and kan resistance.DepositorInsertsfGFP
UseSynthetic BiologyPromoterlacAvailable SinceJune 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-RFP
Plasmid#238040PurposeEncodes mRFP1 under pLux promoter. Expresses a single guide RNA (under Ara promoter), which targets a noncoding region of the plasmid as part of the ADEPT system. Carries oriT and kan resistance.DepositorInsertmRFP1
UseSynthetic BiologyPromoterLuxAvailable SinceJune 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA595 - pBA904 Puro-T2A-mCherry
Plasmid#238171PurposeLentiviral CRISPR guide vector expressing a non-targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertNon-targeting sgRNA
UseCRISPR and LentiviralTagsmCherryAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA594 - pBA904 Puro-T2A-BFP
Plasmid#238170PurposeLentiviral CRISPR guide vector expressing a non-targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertNon-targeting sgRNA
UseCRISPR and LentiviralTagsmTagBFP2Available SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
U6-miR.FF4
Plasmid#235256PurposeNon-intronic (U6-driven) expression of miR-FF4 (FF4 hairpin)DepositorInsertFF4 hairpin
UseSynthetic BiologyExpressionMammalianPromoterU6Available SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp4
Plasmid#238037PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyPromoterlacAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-Msp2
Plasmid#238035PurposeEncodes sfGFP under lac promoter. Expresses a self-targeting mismatched guide RNA as part of the ADEPT system. Carries oriT and kanamycin resistance.DepositorInsertsfGFP
UseSynthetic BiologyPromoterlacAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only