We narrowed to 4,396 results for: erf
-
Plasmid#195044PurposepFA6a derived selection cassette 5' flanked with tCYC1 transcription terminator, allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertNatR
UseYeast genomic targetingTagstCYC1 S. cerevisiae, pPGK1 C. glabrata, NatR, tPG…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
dCas9-NLS-gs10-cDHFR174
Plasmid#188256PurposePlasmid ensures constitutive expression of the C-terminal fragment of split DHFR (aa 1-173), fused to the catalytically inactive Cas9 (dCas9) protein, a flexible GS linker and the SV40 NLS signal at the N-terminusDepositorAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGB 35S:dCas9:Tnos (GB1191)
Plasmid#68223PurposeTranscriptional unit for human codon optimized with mutated (D10A, H840A) and inactivated catalytic domains Cas9 protein plant expression driven by the 35S promoterDepositorInsertdCas9
UseCRISPR and Synthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removed; human codon optimis…Promoter35SAvailable SinceMarch 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 D1-25-msfGFP
Plasmid#180333Purposemammalian expression of human SEPT9_i1 D1-25 fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 D1-25PromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 LIC 6A NLRP1-FLAG E1322R
Plasmid#166809PurposeMammalian cell expression vector for FLAG-tagged NLRP1. The E1322R mutant abolishes interface III UPA-UPA contacts, DPP9 binding, and inflammasome activityDepositorAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTE4565
Plasmid#88903PurposeExpresses inactive/dead, humanized MbCpf1 nucleaseDepositorInserthMbCpf1(D986A)
UseCRISPRTags3xHA and NLSExpressionMammalianPromoterCMVAvailable SinceApril 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
LIC-Z-YFP
Plasmid#153544Purposeperform light induced optogenetic clustering of TCR ζ-Chain tagged with yellow fluorescent protein as described in the associated publicationDepositorInserthuman TCR ζ-Chain (CD247 Human)
TagsVenus YFPExpressionMammalianMutationwith mCherry in LIC-Z replaced by YFPPromoterCMVAvailable SinceJuly 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFLAG R106L-CPTP
Plasmid#170744PurposeThe plasmids contain inserts (ORFs) for expressing various members of the GlycoLipid Transfer Protein (GLTP) superfamily.DepositorAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFLAG K60A-CPTP
Plasmid#170743PurposeThe plasmids contain inserts (ORFs) for expressing various members of the GlycoLipid Transfer Protein (GLTP) superfamily.DepositorAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Islr-AP-His
Plasmid#71950PurposeExpresses the entire Islr protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1-i5-msfGFP
Plasmid#180332Purposemammalian expression of human SEPT9_i1-i5 fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v7 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1-i5PromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-hIRF5-V5(4D)-LPETG
Plasmid#237225PurposeExpresses LPETG-tagged, constitutively active human IRF5 variant in bacteriaDepositorInsertInterferon regulatory factor 5 (IRF5 Human)
Tags6xHisExpressionBacterialMutationS451D, S453D, S456D, S462DAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330_TFAP2C_cterm
Plasmid#222916PurposeCas9/sgRNA plasmid for targeting TFAP2CDepositorInsertCas9, TFAP2C sgRNA (TFAP2C Synthetic, Human)
UseCRISPRAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
mEos3.2trLATm2allL+A
Plasmid#203750PurposeEncodes the transmembrane domain from human LAT with mEos3.2 fused on the C terminus. Residues within the transmembrane domain mutated to L and A to increase the TMD interfacial surface area with the membrane. Used as a fluorescent plasma membrane probe.DepositorAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-MYO10-FERM-ITGBD
Plasmid#194855PurposeExpress EGFP-MYO10 with mutations (S2001_F2002insA/T2009D) that interfere with ITGB binding in mammalian cells.DepositorInsertMYO10 S2001_F2002insA/T2009D (MYO10 Human)
TagsEGFPExpressionMammalianMutationMYO10 has the following mutations S2001_F2002insA…PromoterCMVAvailable SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 S111F-msfGFP
Plasmid#180340Purposemammalian expression of human SEPT9_i1 S111F fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 S111FPromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 R106W-msfGFP
Plasmid#180339Purposemammalian expression of human SEPT9_i1 R106W fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 R106WPromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 NCmut1-msfGFP
Plasmid#180329Purposemammalian expression of human SEPT9_i1 NCmut1 fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 R289A R290A K291A K294APromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 D10-25-msfGFP
Plasmid#180334Purposemammalian expression of human SEPT9_i1 D10-25 fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 D10-25PromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only