We narrowed to 13,725 results for: Cas9
-
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP082
Plasmid#103875PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Kluyveromyces marxianusDepositorInsertHH-gRNA-HDV targetting ADE2 in Kluyveromyces marxianus
UseCRISPRTagsExpressionYeastMutationPromoterScTDH3Available sinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUDP013
Plasmid#103873PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Ogataea (para)polymorphaDepositorInsertHH-gRNA-HDV targetting ADE2 in Ogataea (para)polymorpha
UseCRISPRTagsExpressionYeastMutationPromoterScTDH3Available sinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-CASANOVA
Plasmid#113036PurposeAAV vector for CASANOVA (AcrIIA4-LOV2 hybrid) expression in mammalian cells; enables optogenetic control of SpyCas9DepositorInsertCASANOVA (for CRISPR/Cas9 activity switching via a novel optogenetic variant of AcrIIA4)
UseAAV, CRISPR, and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-PE iSM_PPL2
Plasmid#235996PurposeExpresses iSM_PPL2 prime editor and pegRNA in mammalian cellsDepositorInsertiSM_PPL2_H840A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsbpSV40 NLSExpressionMammalianMutationreplacement of 5 amino acids of Smac-Cas9 PL2 wit…PromoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUDP046
Plasmid#107062PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting KU80 from Ogataea parapolymorphaDepositorInsertHH-gRNA-HDV targetting OpKU80 inO. parapolymorpha
UseTagsExpressionYeastMutationPromoterScTDH3Available sinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-Q03JI6
Plasmid#103123PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertQ03JI6 (Cas9 coding gene from Campylobacter jejuni)
UseCRISPR; Cloning vectorTagsSV40NLSExpressionMutationhuman codon-optimizedPromoterAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330 Mouse 3' Hp1a gRNA
Plasmid#127898PurposeWT Cas9 Vector targeting the 3' end of the mouse Hp1a geneDepositorInsertgRNA/Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
NM-01
Plasmid#69799PurposeBacterial expression of Cas9 with His, MBP, and Strep tagsDepositorInsertCas9
UseTagsHIS, MBP, and StrepIIExpressionBacterialMutationAspartate 10 to Alanine (D10A) and Histidine 840 …PromoterAvailable sinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330 Mouse 5' Npm1 gRNA
Plasmid#127900PurposeWT Cas9 Vector targeting the 5' end of the mouse Npm1 geneDepositorInsertgRNA/Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXZ13lacZalphaKanR
Plasmid#160230PurposeLike pXZ13lacZalpha, but adds second level of selection with Kanamycin resistance.DepositorTypeEmpty backboneUseCRISPRTagsExpressionBacterialMutationPromoterlacAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
UC16m
Plasmid#121038PurposeMoClo golden gate assembly DE part for gQi gRNA (guide RNA for S. pyogenes Cas9; sequence from DOI: 10.1016/j.cell.2013.02.022). Please see Supplemental Documents for annotated Genbank file.DepositorInsertgQi Cas9 gRNA UC part
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
UC17m
Plasmid#121039PurposeMoClo golden gate assembly DE part for gV1 gRNA (guide RNA for S. pyogenes Cas9; sequence from doi: [10.15252/msb.20145735]). Please see Supplemental Documents for annotated Genbank file.DepositorInsertgV1 Cas9 gRNA UC part
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
C114m
Plasmid#121013PurposeMoClo golden gate assembly CD part for Cas9 (S. pyogenes gRNA-targeted endonuclease Cas9, with bbsI cut sites removed synonymously). Please see Supplemental Documents for annotated Genbank file.DepositorInsertdCas9 with no bbsI or BsaI sites
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDM068
Plasmid#216811PurposeVector for Aspergillus CRISPR-Cas9 genetic engineering with Golden Gate cloning drop-out cassette for protospacer insertion and NAT selectable marker.DepositorTypeEmpty backboneUseCRISPR; Fungal expressionTagsExpressionBacterialMutationPromoterAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd (noNLS) nog
Plasmid#119554PurposeCRISPR-Cas9 SunTag system to target NtDRMcd (without an NLS) to specific loci of interest (nog=no guide)DepositorInsertNOS_NLS_GB1_noNLS_linker_DRMcd_linker sfGFP_scFv_UBQ10_Insulator UBQ10_Ω dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBWB424
Plasmid#140638PurposeRSF1010-Cas9-vanAB gRNA. Vector with constitutive Cas9 and gRNA targeting vanAB locus.DepositorInsertCas9
UseTagsExpressionBacterialMutationPromoterAvailable sinceMay 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCasPA
Plasmid#113347PurposeBacterial expression of Cas9 nuclease and λ-Red system in Pseudomonas aeruginosaDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCasSA
Plasmid#98211PurposeCRISPR-based E. coli/Staphylococcus aureus temperature-sensitive plasmid for genome editing in Staphylococcus aureus using S. pyogenes Cas9DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only