We narrowed to 4,483 results for: Gaa
-
Plasmid#92423PurposeExpression of VAMP3 C-terminally conjugated to mCherry.DepositorAvailable SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
VAMP8-mCherry
Plasmid#92424PurposeExpression of VAMP8 C-terminally conjugated to mCherry.DepositorInsertVAMP8 (Vamp8 Mouse)
TagsmCherryExpressionMammalianMutationA36S (Please see Depositor Comments below)PromoterCMVAvailable SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVUTHshGATA1-tTR-KRAB
Plasmid#11650PurposeTet-regulated (Tet-on) lentiviral vector for shGATA1 (hUbiquitin promoter) - 3rd generationDepositorInserthUbiquitin C, GFP, tTR-KRAB, shRNA against GATA1, Tet-on (GATA1 Human)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
WDFY2-GFP
Plasmid#193636PurposeExpresses GFP-tagged WDFY2 in mammalian cellsDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-irf3-shrna5
Plasmid#127649PurposeKnock-down of human IRF3DepositorInsertIRF3 shRNA (IRF3 Human)
UseLentiviralAvailable SinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT2/sh-Col1a1/GFP4_Seq1.2
Plasmid#201403PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
ExpressionMammalianAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shJUND puro
Plasmid#58698PurposeLentiviral shRNA vector for knockdown of human JUNDDepositorAvailable SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shBirc5
Plasmid#160949PurposeBirc5 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-PH-SWAP70(R223E, R224E)
Plasmid#84583PurposeExpresses GFP-tagged PH-domain of SWAP70 in mammalian cells, impaired phosphoinositide bindingDepositorInsertSWAP70 residues 209-306 with mutations R223E and R224E (SWAP70 Human)
TagsEGFPExpressionMammalianMutationPleckstrin-homology domain, residues 209-306, mut…PromoterCMVAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
shMYB-2
Plasmid#247031PurposeUsed for a knockdown of MYB in human Megakaryocyte/Erythroid ProgenitorsDepositorAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
VAMP3(S48A)-mCherry
Plasmid#193635PurposeExpresses S48A phosphodead VAMP3 fused to mCherryDepositorInsertVAMP3 (Vamp3 Mouse)
TagsmCherryExpressionMammalianMutationchanged serine 48 to alaninePromoterCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
VAMP3(S48E)-mCherry
Plasmid#193637PurposeExpresses S48E phosphomimetic VAMP3 fused to mCherryDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
hVAMP3(1-77) WT
Plasmid#206028PurposeExpresses the SNARE motif of wildtype human VAMP3 in bacteriaDepositorInsertVesicle-associated membrane protein 3 (VAMP3 Human)
Tagshis-tagExpressionBacterialPromoterT7Available SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
hVAMP3(1-77) S44A
Plasmid#206029PurposeExpresses the SNARE motif of human VAMP3 mutant S44A in bacteriaDepositorInsertVesicle-associated membrane protein 3 (VAMP3 Human)
Tagshis-tagExpressionBacterialMutationchanges serine 44 to alaninePromoterT7Available SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-30kb-DSF
Plasmid#227483Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 30kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-30kb-DSF
Plasmid#227484Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 30kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-25kb-USF
Plasmid#227468Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 25kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-7.1kb-USF
Plasmid#227474Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 7.1kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-PrPro
Plasmid#227453Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only