We narrowed to 6,620 results for: Rel
-
Plasmid#24737DepositorInsert(sex determining region Y)-box 10 (SOX10 Human)
UseGateway donor vectorMutationG replaced with A at position 128Available SinceMay 18, 2010AvailabilityAcademic Institutions and Nonprofits only -
pFSW Doc2beta 6X mutant
Plasmid#128816PurposeTo make virus expressing Doc2beta 6X mutantDepositorInsertDoc2beta (Doc2b Rat)
UseLentiviralTagsIRES-EGFPMutationD163A, D218A, D220N, D303A, D357A, D359APromoterhSyn (human synapsin I promoter)AvailabilityAcademic Institutions and Nonprofits only -
pET28aAviHisCD72aCTLD
Plasmid#129065Purposegeneration of biotinylated mouse CD72a CTLD protein using bacteriaDepositorInsertCD72a (Cd72 Mouse)
ExpressionBacterialAvailabilityAcademic Institutions and Nonprofits only -
ABCG1_pcDNA6.2/EmGFP-Bsd
Plasmid#176944PurposeMammalian expression vector encoding ABCG1 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
lenti-EF1a-dCas9-KRAB-Puro
Plasmid#99372Purpose3rd generation lenti vector encoding dCas9-KRAB with 2A puromycin resistance marker (EF1a-dCas9-KRAB-T2A-Puro-WPRE)DepositorInsertdCas9-KRAB-T2A-Puro
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1aAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-eGFP
Plasmid#99375PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A eGFP from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-eGFP
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-iRFP670
Plasmid#99377PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A iRFP670 from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-iRFP670
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-mTagBFP2
Plasmid#99374PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A mTagBFP2 from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-TfR20-SNAP-IRES-Puro
Plasmid#171018PurposeLentiviral expression of a transferrin receptor-SNAP-tag fusion in mammalian cellsDepositorInsertTransferrin receptor (Human) - SNAP-tag (TFRC Human)
UseLentiviralTagsSNAPtag and TfRExpressionMammalianPromoterEF1Available SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-GRAB_CRF1.0
Plasmid#208655PurposeExpresses the genetically-encoded fluorescent corticotropin-releasing factor (CRF) sensor GRAB_CRF1.0 in mammalian cellsDepositorInsertGPCR activation based corticotropin-releasing factor (CRF) sensor GRAB_CRF1.0
ExpressionMammalianPromoterCMVAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX304 Flag-mCherry-eEF1A1_IRES-GFP
Plasmid#198383PurposeeEF1A1 fluorescent reporterDepositorAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
miniSOG-Mito-7
Plasmid#57773PurposeLocalization: Mitochondria, Excitation: 448 / 473, Emission: 500 / 528DepositorAvailable SinceJan. 29, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3 TFAM-mScarlet
Plasmid#129573PurposeExpression of mScarlet fused TFAMDepositorAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT2AL200R150G-EGFP-LC3B-RFP-LC3BΔG
Plasmid#168998PurposeExpresses GFP-LC3-RFP-LC3ΔG in zebrafish to measure autophagic fluxDepositorInsertmicrotubule-associated protein 1 light chain 3 beta (Map1lc3b Rat)
UseUnspecifiedTagsEGFP and mRFP1Available SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP-HsNRF2 (NFE2L2)
Plasmid#194303PurposeMammalian expression of human NRF2 (NFE2L2) fused to EGFP at the N-terminus. Parton lab clone KTHDepositorAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hSFTPCpromoter(2kb)-EGFP-EF1a-TagRFP
Plasmid#201681PurposeLentiviral vector for human SFTPC promoter (2kb)-driven expression of EGFP and EF1a-driven TagRFP expressionDepositorInsertsSFTPC promoter region (2kb upstream)
TagRFP
UseLentiviralExpressionMammalianAvailable SinceNov. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
hFLT1
Plasmid#83435Purposehuman VEGFR1 with HA and FLAG tagDepositorInserthuman VEGFR1 (FLT1 Human)
TagsFlag and MycExpressionMammalianMutationHA-tag was inserted 30 AA downstream of the FLT1 …PromoterCMVAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Hygro-dTomato
Plasmid#99376PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and hygromycin resistance marker with 2A dTomato from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Hygro-P2A-dTomato
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
Nsp3 -EGFP
Plasmid#165108Purposemammalian expression and localizationDepositorAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only